Transcript asmbl_63181

Sequence
Transcript Sequence for observation asmbl_63181 of TGE0060551:
CAGACTTTCTATTATGCTGTTGCTGTGGTGAAGAAGGATAGTGGCTTCCAGATGAACCAGCTTCGAGGCAAGAAGTCCTGCCACACGGGTCTAGGCAGGTCCGCTGGGTGGAACATCCCCATAGGCTTACTTTACTGTGACTTACCTGAGCCACGTAAACCTCTTGAGAAAGCAGTGGCCAATTTCTTCTCGGGCAGCTGTGCCCCTTGTGCGGATGGGACGGACTTCCCCCAGCTGTGTCAACTGTGTCCAGGGTGTGGCTGCTCCACCCTTAACCAATACTTCGGCTACTCGGGAGCCTTCAAGTGTCTGAAGGATGGTGCTGGGGATGTGGCCTTTGTCAAGCACTCGACTATATTTGAGAACTTGGCAAACAAGGCTGACAGGGACCAGTATGAGCTGCTTTGCCTGGACAACACCCGGAAGCCGGTAGATGAATACAAGGACTGCCACTTGGCCCAGGTCCCTTCTCATACCGTCGTGGCCCGAAGTATGGGCGGCAAGGAGGACTTGATCTGGGAGCTTCTCAACCAGGCCCAGGAACATTTTGGCAAAGACAAATCAAAAGAATTCCAACTATTCAGCTCTCCTCATGGGAAGGACCTGCTGTTTAAGGACTCTGCCCACGGGTTTTTAAAAGTCCCCCCCAGGATGGATGCCAAGATGTACCTGGGCTATGAGTATGTCACTGCCATCCGGAATCTACGGGAAGGCACATGCCCAGAAGCCCCAACAGATGAATGCAAGCCTGTGAAGTGGTGTGCGCTGAGCCACCACGAGAGGCTCAAGTGTGATGAGTGGAGTGTTAACAGTGTAGGGAAAATAGAGTGTGTATCAGCAGAGACCACCGAAGACTGCATCGCCAAGATCATGAATGGAGAAGCTGATGCCATGAGCTTGGATGGAGGGTTTGTCTACATAGCGGGCAAGTGTGGTCTGGTGCCTGTCTTGGCAGAAAACTACAATAAGAGCGATAATTGTGAGGATACACCAGAGGCAGGGTATTTTGCTATAGCAGTGGTGAAGAAATCAGCTTCTGACCTCACCTGGGACAATCTGAAAGGCAAGAAGTCCTGCCATACGGCAGTTGGCAGAACCGCTGGCTGGAACATCCCCATGGGCCTGCTCTACAATAAGATCAACCACTGCAGATTTGATGAATTTTTCAGTGAAGGTTGTGCCCCTGGGTCTAAGAAAGACTCCAGTCTCTGTAAGCTGTGTATGGGCTCAGGCCTAAACCTGTGTGAACCCAACAACAAAGAGGGATACTACGGCTACACAGGCGCTTTCAGGTGTCTGGTTGAGAAGGGAGATGTGGCCTTTGTGAAACACCAGACTGTCCCACAGAACACTGGGGGAAAAAACCCTGATCCATGGGCTAAGAATCTGAATGAAAAAGACTATGAGTTGCTGTGCCTTGATGGTACCAGGAAACCTGTGGAGGAGTATGCGAACTGCCACCTGGCCAGAGCCCCGAATCACGCTGTGGTCACACGGAAAGATAAGGAAGCTTGCGTCCACAAGATATTACGTCAACAGCAGCACCTATTTGGAAGCAACGTAACTGACTGCTCGGGCAACTTTTGTTTGTTCCGGTCGGAAACCAAGGACCTTCTGTTCAGAGATGACACAGTATGTTTGGCCAAACTTCATGACAGAAACACATATGAAAAATACTTAGGAGAAGAATATGTCAAGGCTGTTGGTAACCTGAGAAAATGCTCCACCTCATCACTCCTGGAAGCCTGCACTTTCCGTAGACCTTAAAATCTCAGAGGTAGGGCTGCCACCAAGGTGAAGATGGGAACGCAGATGATCCATGAGTTTGCCCTGGTTTCACTGGCCCAAGTGGTTTGTGCTAACCACGTCTGTCTTCACAGCTCTGTGTTGCCATGTGTGCTGAACAAAAAATAA