Transcript asmbl_61459

Sequence
Transcript Sequence for observation asmbl_61459 of TGE0001731:
GCTCGAGCCCGCTGGGCACTCGGAGGCGCGCACGTCGTTCCCCGCCCTCCCGCCGCCGCCCGCCCTCGCTCTCTCGCGCTACCCTCCCGCCGCCCGCGGTCCTCCGTCGGTTCTCTCGTTAGTCCACGGTCTGGTCTTCAGCTACCCGCCTTCGTCTCCGAGTTTGCGACTCGCGGACCGGCGTCCCCGGCGCGAAGAGGCTGGACTCGGATTCGTTGCCTGAGCAATGGCTGCCATCCGGAAGAAACTGGTGATTGTTGGTGATGGAGCCTGTGGAAAGACATGCTTGCTCATAGTCTTCAGCAAGGACCAGTTCCCAGAGGTGTATGTGCCCACAGTGTTTGAGAACTATGTGGCAGATATCGAGGTGGATGGAAAGCAGGTAGAGTTGGCTTTGTGGGACACAGCTGGGCAGGAAGATTATGATCGCCTGAGGCCCCTCTCCTACCCAGATACCGATGTTATACTGATGTGTTTTTCCATCGACAGCCCTGATAGTTTAGAAAACATCCCAGAAAAGTGGACCCCAGAAGTCAAGCATTTCTGTCCCAACGTGCCCATCATCCTGGTTGGGAATAAGAAGGATCTTCGGAATGATGAGCACACAAGGCGGGAGCTAGCCAAGATGAAGCAGGAGCCGGTGAAACCTGAAGAAGGCAGAGATATGGCAAACAGGATTGGCGCTTTTGGGTACATGGAGTGTTCAGCAAAGACCAAAGATGGAGTGAGAGAGGTTTTTGAAATGGCTACGAGAGCTGCTCTGCAAGCTAGACGTGGGAAGAAAAAATCTGGGTGCCTTGTCTTGTGAAACCTTGCTGCAAGCACAGCCCTTATGCGGTTAATTTTGAAGTGCTGTTTATTAATCTTAGTGTATGATTACTGGCCTTTTTCATTTATCTATAATTTACCTAAGATTACAAATCAGAAGTCATCTTGCTACCAGTATTTAGAAGCCAACTATGATTATTAACGATGTCCAACCCGTCTGGCCCACCAGGGTCCTTTTGACACTGCTCTAACAGCCCTCCTCTGCACTCCCACCTGACACACCAGGCGCTAATTCAAGGAATTTCTTAACTTCTTGCTTCTTTCTAGAAAGAGAAACAGTTGGTAACTTTTGTGAATTAGGCTGTAACTACTTTATAACTAACATGTCCTGCCTATTATCTGTCAGCTGCAAGGTACTCTGGTGAGTCACCACTTCAGGGCTTTACTCCGTAACAGATTTTGTTGGCATAGCTCTGGGGTGGGCAGTTTTTTGAAAATGGGCTCAACCAGAAAAGCCCAAGTTCATGCAGCTGTGGCAGAGTTACAGTTCTGTGGTTTCATGTTAGTTACCTTATAGTTACTGTGTAATTAGTGCCACTTAATGTATGTTACCAAAAATAAATATATCTACCCCAGACTAGATGTAGTATTTTTTGTATAATTGGATTTCCTAATACTGTCATCCTCAAAGAAAGTGTATTGGTTTTTTAAAAAAGAAAGTGTATTTGGAAATAAAGTCAGATGGAAAATTCATTTTTTAAATTCCCGTTTTGTCACTTTTTCTGATAAAAGATGGCCATATTACCCCTTTTCGGCCCCATGTATCTCAGTACCCCATGGAGCTGGGCTAAGTAAATAGGAATTGGTTTCACGCCTGAGGCAATTAGACACTTTGGAAGATGGCATAACCTGTCTCACCTGGACTTAAGCATCTGGCTCTAATTCACAGTGCTCTTTTCTCCTCACTGTATCCAGGTTCCCTCCCAGAGGAGCCACCAGTTCTCATGGGTGGCACTCAGTCTCTCTTCTCTCCAGCTGACTAAACTTTTTTTCTGTACCAGTTAATTTTTCCAACTACTAATAGAATAAAGGCAGTTTTCTAAA