Transcript asmbl_59271

Sequence
Transcript Sequence for observation asmbl_59271 of TGE0001625:
TTTCCGCTGCTGCTTCTGTGAGTTTTTCCGGTGCACGCGAGTGCTTCTGAAACGTCAGCTGCGCTCCCCTAGGAGTGCTGAGCCCGCGGAACCGCAGCCATGACTGAGGCTGATGTGAATCCAAAGGCCTATCCCCTTGCCGATGCCCACCTCACCAAGAAGCTACTGGACCTCGTTCAGCAGTCATGTAACTATAAGCAGCTTCGGAAAGGAGCCAATGAGGCCACCAAAACCCTCAACAGGGGCATCTCTGAGTTCATCGTGATGGCTGCAGACGCCGAGCCACTGGAGATCATTCTGCACCTGCCGCTGCTGTGTGAAGACAAGAATGTGCCCTACGTGTTTGTGCGCTCCAAGCAGGCCCTGGGGAGAGCCTGTGGGGTCTCCAGGCCTGTCATCGCCTGTTCTGTCACCATCAAAGAAGGCTCGCAGCTGAAACAGCAGATCCAATCCATTCAGCAGTCCATTGAAAGGCTCTTAGTCTAAACCTGTGGCCTCTGCCACGTGCTCCCTGCCAGCTTCCCCCCTGAGGTTGTGTATCATATTATCTGTGTTAGCATGTAGTATTTTCAGCTACTCTCTATTGTTATAAAATGTAGTACTAAATCTGGTTTCTGGATTTTTGTGTTGTTTTTGTTCTGTTTTACAGGGTTGCTATCCCCCTTCCTTTCCTCCCTCCCTCTGCCATCCTTCATCCTTTTATCCTCCCTTTTTGGAACAAGTGTTCAGAGCAGACAGAAGCAGGGTGGTGGCACCGTTGAAAGGCAGAAAGAGCCAGGAGAAAGCTGATGGAGCCAGGACAGAGATCTGGTTCCAGCTTTCAGCCACTAGCTTCCTGTTGTGTGCGGGGTGTGGTGGAATTAAACAGCATTCATTGTGTGTCCCTGTGCCTGGCACACAGAATCATTCATACGTGTTCAAGTGATCAAGGGGTTTCATTTGCTCTTGGGGGATTAGGTATCATTTGGGGAGGAAGCATGTGTTCTGTGAGGTTGTTCGGCTATGTCCAAGTGTCGTTTACTAATGTACCCCTGCTGTTTGCTTTTGGTAATGTGATGTTGATGTTCTCCCCCTACCCACAACCATGCCCTTGAGGGTAGCAGGGCAGCAGCATACCAAAGAGATGTGCTGCAGGACTCCGGAGGCAGCCTGGGTGGGTGAGCCATGGGGCAGTTGACCTGGGTCTTGAAAGAGTCGGGAGTGACAAGCTCAGAGAGCATGAACTGATGCTGGCATGAAGGATTCCAGGAAGATCATGGAGACCTGGCTGGTAGCTGTAACAGAGATGGTGGAGTCCAAGGAAACAGCCTGTCTCTGGTGAATGGGACTTTCTTTGGTGGACACTTGGCACCAGCTCTGAGAGCCCTTCCCCTGTGTCCTGCCACCATGTGGGTCAGATGTACTCTCTGTCACATGAGGAGAGTGCTAGTTCATGTGTTCTCCATTCTTGTGAGCATCCTAATAAATCTGTTCCATTTTGATGACAG