Transcript asmbl_5241

Sequence
Transcript Sequence for observation asmbl_5241 of TGE0060494:
AGTGGCGGAAGGGCAGACCCTGGATCTGAACTGCGTGGTGCCCGGGCAGTCCCATGCCCAGGTCACGTGGCACAAGCGTGGGGGCAGCCTCCCTGTCCGGCACCAGACCCACGGCTCCCTGCTGAGACTCTACCAAGCGTCCCCCGCCGACTCGGGCGAGTACGTGTGCCGAGTGTTGGGCAGCTCCGTGCCTCTAGAGGCCTCTGTCCTGGTCACCATTGAGCCTGCGGGCTCAGTGCCTGCACTTGGGGTCACCCCCACGGTCCGGATCGAGTCATCGTCTTCGCAAGTGGCCGAGGGGCAGACCCTGGACCTGAACTGCCTCGTTGCTGGTCAGGCCCATGCCCAGGTCACGTGGCACAAGCGCGGGGGCAGCCTCCCGGCCCGGCACCAGGTGCATGGCTCGAGGCTACGCCTGCTCCAGGTGACCCCAGCTGATTCAGGGGAGTACGTGTGCCGTGTGGTCGGCAGCTCAGGTACCCAGGAAGCCTCAGTCCTTGTCACCATCCAGCAGCGCCTTAGTGGCTCCCACTCCCAGGGTGTGGCGTACCCCGTCCGCATCGAGTCCTCCTCAGCCTCCCTGGCCAATGGACACACCCTGGACCTCAACTGCCTGGTTGCCAGCCAGGCTCCCCACACCATCACCTGGTATAAGCGTGGAGGCAGCTTACCCAGCCGGCACCAGATCGTGGGCTCCCGGCTGCGGATCCCTCAGGTGACTCCGGCAGACTCGGGCGAGTACGTGTGTCACGTCAGTAACGGTGCAGGCTCCCGGGAGACCTCGCTCATCGTCACCATCCAGGGCAGCGGTTCCTCCCACGTGCCCAGCGTCTCCCCACCGATCAGGATCGAGTCGTCTTCCCCCACGGTGGTGGAAGGGCAGACCTTGGATCTGAACTGCGTGGTCGCCAGGCAGCCCCAGGCTATCATCACATGGT