Transcript asmbl_30895

Sequence
Transcript Sequence for observation asmbl_30895 of TGE0004797:
CGGAGACATGAGTTGGAGGTAACCCCATAACCTGAGACAGCCAGTGAACCGCCTCACACCTAGCTGGAAAAAGACACCTGCTGGCTTTATTTTGGGGGACAATGTGGCTTCCTCCAGAAGGCCTCTCCAGTGTATCTGTGGCCAATCTTGGCAAAAAAAGAATGCTCTGGATTAGGGATTGTCAAACTATGGCCCATAGGGTAAACACAGCCTGCTGTTTGTATAAAGTTTTACTGGAACAAAGCCATGCTCATTTGTTTATGTACTGTTTAAGGCTGCTGTTATGAAACAATAGCAGAAATGGCCTGCAAAGCCTAAAATACTTATTGTCTGGTAATTTACAAAAAAGCTCACTGACCCCTGGCTCCAGAATGCCCAAGATCTGGTCTCCTGTTTCTCCGGTCTCCAAGTTTGGAGAAGCCCCTGGCCTAGATGGGCAATGCCATGAAAACAATATCAGGAAGAAAGGGGAGAAAGATAAACATCTAGGAGGGTTGGGCAGCCACAGAGCTAGACCTGCCCGGCACAAGTGAAAGTGGGGCTGCTCTCTCACCCCGATCTTCCCCGTTGCTGGCTGGTGCTGCTGTAGCTCTCCCTAAACATGGCCAACAAGGGACCTTCCTACGGCATGAGTCGTGAAGTGCAATCCAAAATTGAGAAGAAGTACGACGAGGAGCTGGAGGAGCGGCTGGTGGAGTGGATTGTGGTGCAGTGTGGCCCTGACGTGGGTCGCCCAGACCGCGGGCGCCTGGGCTTCCAGGTCTGGCTGAAGAACGGCGTGATTCTGAGCAAACTGGTGAACAGCCTGTATCCTGATGGTTCCAAGCCAGTGAAGGTGCCTGAGAACCCCCCTTCCATGGTCTTCAAGCAGATGGAGCAGGTGGCTCAGTTCCTGAAGGCAGCTGAAGACTATGGAGTCACCAAGACTGACATGTTCCAGACTGTTGACCTCTTTGAAGGCAAAGACATGGCAGCAGTACAGAGGACCCTAATGGCTCTGGGCAGCTTGGCAGTGACCAAGAACGATGGGCACTACCGTGGAGATCCCAACTGGTTTATGAAGAAAGCCCAGGAGCATAAGAGGGAATTCACAGAGAGCCAACTGCAGGAGGGAAAGCATGTCATTGGCCTACAGATGGGCAGCAACAGAGGGGCTTCCCAGGCTGGCATGACGGGCTACGGACGACCTCGGCAGATCATCAGTTAGAGGACGAGGGCCAGCCCCCAGTCCTTTCCTGCCCCGGCTCATTGGCTGCAGCCATCTATCCTGCCTAGCCCACCTCACCCACACCCGTGTAATTCCTTCAGCCCCGGCCAAGCTTCGAGTCTCCGAGGCTCTGTCACTGAGCAAAGGTGACTTGCGCTTGGGCAACTCTCCCCACCCTCCTCAGCCTCAGCTGAACTTCTTACCCCAAAGCACTGCTCCCTGGGCCCTCCTTCAACCTCCCACCACCTCTACTGAGCTGAGCAAGGGGGTGTGGGCTGGGGGTGGTCTGGGTGTGGGGCAAGTCCACTGCGCTCCTTGGCAGCAGATGCCCATTGAAGGAGACCCAGCCCAACCTCCCCCCATTTTTTGCTGGAATATTTTGGGGGTTGAAATTCAAGAAGGAAAAAAAAATATATATATATATCTATA