Transcript asmbl_49648

Sequence
Transcript Sequence for observation asmbl_49648 of TGE0060461:
GCGCATGCTCAGAGTTCCGGGGCACGGTTTCCCCGCCCCTTTCAGGCCTAGCAGGAAACGAAGCGGCTCTTTCCGCTATCTGCCGCTTGTCCACCGGAAGCGAGTTGCGACACGGCAGGTTCCCGCCCGGAAGAAGCGACCAAAGCGCCTGAGGACCGGCAACATGGTGCGGTCGGGGAATAAGGCAGCTGTTGTGCTGTGTATGGACGTGGGCTTTACCATGAGTAACTCCATTCCTGGTATAGAATCCCCATTTGAACAAGCAAAGAAGGTGATAACCATGTTTGTACAGCGACAGGTGTTTGCTGAGAACAAGGATGAGATTGCTTTAGTCCTGTTTGGTACAGATGGCACTGACAATCCCCTTTCTGGTGGGGATCAGTATCAGAACATCACAGTGCACAGACATCTGATGCTACCAGATTTTGATTTGCTGGAGGACATTGAAAGCAAAATCCAACCAGGTTCTCAACAGGCTGACTTCCTGGATGCACTAATCGTGAGCATGGATGTGATTCAACATGAAACAATAGGAAAGAAGTTTGAGAAGAGGCATATTGAAATATTCACTGACCTCAGCAGCCGATTCAGCAAAAGTCAGCTGGATATTATAATTCATAGCTTGAAGAAATGTGACATCTCCCTGCAATTCTTCTTGCCTTTCTCACTTGGCAAGGAAGATGGAAGTGGGGACAGAGGAGATGGCCCCTTTCGCTTAGGTGGCCATGGGCCTTCCTTTCCACTAAAAGGAATTACCGAACAGCAAAAAGAAGGTCTTGAGATAGTGAAAATGGTGATGATATCTTTAGAAGGTGAAGATGGGTTGGATGAAATTTATTCATTCAGTGAGAGTCTGAGAAAACTGTGCGTCTTCAAGAAAATTGAGAGGCATTCCATTCACTGGCCCTGCCGACTGACCATTGGCTCCAATTTGTCTATAAGGATTGCAGCCTATAAATCGATTCTACAGGAGAGAGTTAAAAAGACTTGGACAGTTGTGGATGCAAAAACCCTAAAAAAAGAAGATATACAAAAAGAAACAGTTTATTGCTTAAATGATGATGATGAAACTGAAGTTTTAAAAGAGGATATTATTCAAGGGTTCCGCTATGGAAGTGATATAGTTCCTTTCTCTAAAGTGGATGAGGAACAAATGAAATATAAATCGGAGGGGAAGTGCTTCTCTGTTTTGGGATTTTGTAAATCTTCTCAGGTTCAGAGAAGATTCTTCATGGGAAATCAAGTTCTAAAGGTCTTTGCAGCAAGAGATGATGAGGCAGCTGCAGTTGCACTTTCCTCCCTGATTCATGCTTTGGATGACTTAGACATGGTGGCCATAGTTCGATATGCTTATGACAAAAGAGCTAATCCTCAAGTCGGCGTGGCTTTTCCTCATATCAAGCATAACTATGAGTGTTTAGTGTATGTGCAGCTGCCTTTCATGGAAGACTTGCGGCAATACATGTTTTCATCCTTGAAAAACAGTAAGAAATATGCTCCCACCGAGGCACAGTTGAATGCTGTTGATGCTTTGATTGACTCCATGAGCTTGGCAAAGAAAGATGAGAAGACAGACACCCTTGAAGACTTGTTTCCAACCACCAAAATCCCAAATCCTCGATTTCAGAGATTATTTCAGTGTCTGCTGCACAGAGCTTTACATCCCCGGGAGCCTCTACCCCCAATTCAGCAGCATATTTGGAATATGCTGAATCCTCCCGCTGAGGTGACAACAAAAAGTCAGATTCCTCTCTCTAAAATAAAGACCCTTTTTCCTCTGATTGAAGCCAAGAAAAAGGATCAAGTGACTGCTCAGGAAATTTTCCAAGACAACCATGAAGATGGACCTACAGCTAAAAAATTAAAGACTGAGCAAGGGGGAGCCCACTTCAGCGTCTCCAGTCTGGCTGAAGGCAGTGTCACCTCTGTTGGAAGTGTGAATCCTGCTGAAAACTTCCGTGTTCTAGTGAAACAGAAGAAGGCCAGCTTTGAGGAAGCGAGTAACCAGCTCATAAATCACATCGAACAGTTTTTGGATACTAATGAAACACCGTATTTTATGAAGAGCATAGACTGCATCCGAGCCTTCCGGGAAGAAGCCATTAAGTTTTCAGAAGAGCAGCGCTTTAACAACTTCCTGAAAGCCCTTCAAGAGAAAGTGGAAATTAAACAATTAAATCATTTCTGGGAAATTGTTGTCCAGGATGGAATTACTCTGATCACCAAAGAGGAAGCCTCTGGAAGTTCTGTCACAGCTGAGGAAGCCAAAAAGTTTCTGGCCCCCAAAGACAAACCAAGTGGAGACACAGCAGCTGTATTTGAAGAAGGTGGTGATGTGGACGATTTATTGGACATGATATAGGTCGTGGATGTATGGGGAATCTAAGAGAGCTGCCATCGCTGTGATGCTGGGAGTTCTAACAAAACAAGTTGGATGCGGCCATTCAAGGGGAGCCAAAATCTCAAGAAATTCCCAGCAGGTTACCTGGAGGCGGATCATCTAATTCTCTGTGGAATGAATACACACATATATATTACAAGGGATAATTTAGACCCCATACAAGTTTATAAAGAGTCATTGTTATTTTCTGGTTGGTGTATTATTTTTTCTGTGGTCTTACTGATCTTTGTATATTACATACATGCTTTGAAGTTTCTGGAAAGTAGATCTTTTCTTGACCTAGTATATCAGTGACAGTTGCAGCCCTTGTGATGTGATTAGTGTCTCATGTGGAACCATGGCATGGTTATTGATGAGTTTCTTAACCCTTTCCAGAGTCCTCCTTTGCCTGATCCTCCAACAGCTGTCACAACTTGTGTTGAGCAAGCAGTAGCATTTGCTTCCTCCCAACAAGCAGCTGGGTTAGGAAAACCATGGGTAAGGACGGACTCACTTCTCTTTTTAGTTGAGGCCTTCTAGTTACCACATTACTCTGCCTCTGTATATAGGTGGTTTTCTTTAAGTGGGGTGGGAAGGGGAGCACAATTTCCCTTCATACTCCTTTTAAGCAGTGAGTTATGGTGGTGGTCTCATGAAGAAAAGACCTTTTGGCCCAATCTCTGCCATATCAGTGAACCTTTAGAAACTCAAAAACTGAGAAATTTACTACAGTAGTTAGAATTATATCACTTCACTGTTCTCTACTTGCAAGCCTCAAAGAGAGAAAGTTTCGTTATATTAAAACACTTAGGTAACTTTTCGGTCTTTCCCATTTCTACCTAAGTCAGCTTTCATCTTTGTGGATGGTGTCTCCTTTACTAAATAAGAAAATAACAAAGCCCTTATTCTCTTTTTTTCTTGTCCTCATTCTTGCCTTGAGTTCCAGTTCCTCTTTGGTGTACAGACTTCTTGGTACCCAGTCACCTCTGTCTTCAGCACCCTCATAAGTCGTCACTAATACACAGTTTTGTACATGTAACATTAAAGGCATAAATGACTCA