Transcript asmbl_49598

Sequence
Transcript Sequence for observation asmbl_49598 of TGE0006627:
GTTCTTCCACAGCTACTGGTCTGCAGCTGTTCTTATGGTAGCAGTTGTGGCATTCCTCTGTGGGAAAGAAACTGTTAACACAAACACCTCTTTCTTAGCAAAACAGAAAGTGGGTATATATGTGTGACAGACACAAGATGTATCTGTAGTTTTGTTTGGCTAAGGAGATAGTCTCAAAACAAATTGAGATGGATTTGTTTGTGTCTTGGAGTAGGGTGAAAAAAATACAATTCATTATTTGAATAATGCTGTTTATTGTTTTTAGAACCTGCACTTGTTGCCAAGTCTTCCATCTTACTAGATGTGAAACCTTGGGATGATGAGACAGATATGGCGAAATTAGAGGAGTGCGTCAGAAGCATTCAAGCAGACGGCTTAGTCTGGGGCTCATCTAAACTAGTTCCAGTGGGATACGGAATTAAGAAACTTCAAATACAGTGTGTAGTTGAAGATGATAAAGTTGGAACAGATATGCTGGAGGAGCAGATCACTGCTTTTGAGGACTATGTGCAGTCCATGGATGTGGCTGCTTTCAACAAGATCTAAAATCCATCCTGGATCATGGCATTTAAATAAAAGATTGAAAGATTA