Transcript asmbl_49557

Sequence
Transcript Sequence for observation asmbl_49557 of TGE0060458:
CCTCAGAGAAGGAGTAGCGCGTTCGTGCGTCCTAGTTCCAGTACAGCGTGGAGGGTTTAGGCAGCGTGTTCTGATTCTTTGCGGGACGGCGAGCGCATTTGTGCTTTGCCCGCCGCGGCCTAGGAGGCCTTTTGAGGCCGCGTAGTCGGTGTTTTTGAACTGACTCTACAGCTTCTGGCAGGCCGTGCGGCGCCCTGACCCGGCCTCACCATGTTGGTGCTGTTTGAAACGTCTGTGGGTTACGCCATCTTTAAGGTTCTAAATGAGAAGAAACTTCAAGAGGTTGATAGTTTATGGAAAGAATTTGAAACTCCAGAGAAAGCAAACAAAATAGTAAAGCTAAAACATTTTGAGAAATTTCAGGATACAGCAGAAGCATTAGCAGCATTCACAGCTCTGATGGAGGGCAAAATCAATAAGCAGCTGAAAAAAGTTCTGAAGAAAATAGTAAAAGAAGCCCATGAACCGCTGGCAGTAGCTGATGCTAAACTAGGAGGGGTCATAAAGGAAAAGCTGAATCTCAGTTGTATCCATAGTCCTGTTGTTAATGAACTTATGAGAGGAATTCGTTCACAAATGGATGGATTAATCCCTGGGGTAGAACCACGTGAAATGGCAGCTATGTGTCTTGGATTGGCTCACAGCCTGTCTCGATATAGATTGAAGTTTAGCGCTGATAAAGTAGACACAATGATTGTTCAGGCAATTTCCTTGTTAGATGACTTGGATAAAGAACTAAACAACTACATTATGCGATGTAGAGAATGGTATGGCTGGCATTTCCCTGAATTAGGAAAAATTATTTCAGATAATTTAACATACTGCAAGTGTTTACAGAAAGTTGGCGATAGGAAGAACTATGCCTCTGCCAAGCTTTCTGAGTTGCTGCCAGAAGAAGTTGAAGCAGAAGTGAAAGCAGCTGCAGAGATATCAATGGGAACAGAGGTTTCAGAAGAAGATATTTGCAATATTCTGCATCTTTGCACCCAGGTGATTGAAATCTCTGAATATCGAACCCAGCTCTATGAATATCTACAAAATCGAATGATGGCCATTGCACCCAATGTTACAGTCATGGTTGGGGAATTAGTTGGAGCACGGCTTATTGCTCATGCAGGTTCTCTTTTAAATTTGGCCAAGCATGCAGCTTCTACCGTTCAGATTCTTGGAGCTGAAAAGGCACTTTTCAGAGCCCTCAAATCTAGACGGGATACCCCTAAGTATGGTCTCATTTATCATGCTTCACTCGTGGGCCAGACAAGTCCCAAACACAAAGGAAAGATTTCTCGAATGCTGGCAGCCAAAACCGTTTTGGCTATCCGTTATGATGCTTTTGGTGAGGATTCAAGTTCTGCAATGGGAGTTGAGAACAGAGCCAAATTAGAGGCCAGGTTGAGAACTTTGGAAGACAGAGGGATAAGAAAAATAAGTGGAACAGGAAAAGCATTAGCAAAAACAGAAAAATATGAACACAAAAGGTGAGTACATTTAAGTGAGGATGGGGTGAATAGTTTTTTTAAATGTTAATTATTGACAGTAATTTTTTATTGTAAACTTCACCTTGATGTGCCCATAGTTTTTTCAAATTTATTTATTTG