Transcript asmbl_49556

Sequence
Transcript Sequence for observation asmbl_49556 of TGE0060457:
CCTCAGAGAAGGAGTAGCGCGTTCGTGCGTCCTAGTTCCAGTACAGCGTGGAGGGTTTAGGCAGCGTGTTCTGATTCTTTGCGGGACGGCGAGCGCATTTGTGCTTTGCCCGCCGCGGCCTAGGAGGCCTTTTGAGGCCGCGTAGTCGGTGTTTTTGAACTGACTCTACAGCTTCTGGCAGGCCGTGCGGCGCCCTGACCCGGCCTCACCATGTTGGTGCTGTTTGAAACGTCTGTGGGTTACGCCATCTTTAAGGTTCTAAATGAGAAGAAACTTCAAGAGGTTGATAGTTTATGGAAAGAATTTGAAACTCCAGAGAAAGCAAACAAAATAGTAAAGCTAAAACATTTTGAGAAATTTCAGGATACAGCAGAAGCATTAGCAGCATTCACAGCTCTGATGGAGGGCAAAATCAATAAGCAGCTGAAAAAAGTTCTGAAGAAAATAGTAAAAGAAGCCCATGAACCGCTGGCAGTAGCTGATGCTAAACTAGGAGGGGTCATAAAGGAAAAGCTGAATCTCAGTTGTATCCATAGTCCTGTTGTTAATGAACTTATGAGAGGAATTCGTTCACAAATGGATGGATTAATCCCTGGGGTAGAACCACGTGAAATGGCAGCTATGTGTCTTGGATTGGCTCACAGCCTGTCTCGATATAGATTGAAGTTTAGCGCTGATAAAGTAGACACAATGATTGTTCAGGCAATTTCCTTGTTAGATGACTTGGATAAAGAACTAAACAACTACATTATGCGATGTAGAGAATGGTATGGCTGGCATTTCCCTGAATTAGGAAAAATTATTTCAGATAATTTAACATACTGCAAGTGTTTACAGAAAGTTGGCGATAGGAAGAACTATGCCTCTGCCAAGCTTTCTGAGTTGCTGCCAGAAGAAGTTGAAGCAGAAGTGAAAGCAGCTGCAGAGATATCAATGGGAACAGAGGTTTCAGAAGAAGATATTTGCAATATTCTGCATCTTTGCACCCAGGTGATTGAAATCTCTGAATATCGAACCCAGCTCTATGAATATCTACAAAATCGAATGATGGCCATTGCACCCAATGTTACAGTCATGGTTGGGGAATTAGTTGGAGCACGGCTTATTGCTCATGCAGGTTCTCTTTTAAATTTGGCCAAGCATGCAGCTTCTACCGTTCAGATTCTTGGAGCTGAAAAGGCACTTTTCAGAGCCCTCAAATCTAGACGGGATACCCCTAAGTATGGTCTCATTTATCATGCTTCACTCGTGGGCCAGACAAGTCCCAAACACAAAGGAAAGGTGTGTTATAGGGTTTTGCTTTGTTTTTGAGGTTAGACTTTTTCATTTTTTACAACCCATTTTTCTTCTACTCTGTAGTACACATTAAATCTTCTATTGTCTCTTTCTTGTTAAATAGGG