Transcript asmbl_48752

Sequence
Transcript Sequence for observation asmbl_48752 of TGE0060453:
CTGCGGTGGGTGTCTGCACTTCGGCTGCTCTCGGGTTAGCACCCTATGGTGCCTTCTCTTGTGATCCCTGACCTAACCTGTCTCTTCCTTTTCCTCAACCTCAGGTGGAGCCGCCACCAAAATGCAGATTTTCGTGAAAACCCTTACGGGGAAGACCATCACCCTCGAGGTTGAACCCTCGGATACGATAGAAAATGTAAAGGCCAAGATCCAGGATAAGGAAGGAATTCCTCCTGATCAGCAGAGACTGATCTTTGCTGGCAAGCAGCTGGAAGATGGACGTACTTTGTCTGACTACAATATTCAAAAGGAGTCTACTCTTCATCTTGTGTTGAGACTTCGTGGTGGTGCTAAGAAAAGGAAGAAGAAGTCTTACACCACTCCCAAGAAGAATAAGCACAAGAGAAAGAAGGTTAAGCTGGCTGTCCTGAAATATTATAAGGTGAGCCAGTTAAAGGGCAGAATGTCAGCAAAGTCTTGGCTTATTTGGAAAACTTAATCTTTATAGTACTTGTCAATATTTTCTTGGACTTAAACACCCAATATTATCCCACTTTGGTTTAAATGAGGTATTCTGGAAATGAGAAATTCAGACTTTCTGGGGTTTTTCCTGTTTGGTATTTGAAATCAGTTATGTAATAGGGTTCTGAGTTTAAAGTCGGGTTTGGGTTCAGGTCTTTACCTTTGTCTACCACTTGCAAAGCTGGCCTTTAGTGTTCAAAAGTCCCAAGACTTCTGAATGTTTTCATTGTAGCAATGATAACTGGTGAGAATTTAGGGTGCTTTGGTTTGTAAGCACCAAAACCACCAGTATTACACAGTTAAAAGCTTAAATATTTTGAGTCACTTAAATTAGACTTCAGAATGTGTTGTAAAATTATCTTAACAGCAGGTTTGTGCTTTTCAGGTGGATGAGAATGGCAAAATTAGTCGCCTTCGTCGAGAGTGCCCTTCTGATGAATGTGGTGCTGGGGTGTTTATGGCAAGTCACTTTGACAGACATTATTGTGGCAAATGTTGTCTGACTTACTGTTTCAACAAACCAGAAGACAAGTAACTGTATGAGTTAATAAAAGACATGAACTAACATTTATTGTTGGGTTTTAT