Transcript asmbl_48746

Sequence
Transcript Sequence for observation asmbl_48746 of TGE0060450:
CTTAGCTGTTGAAGGAAAACGAATTGGAAAGGTGCTTGACAATGCTATTGAAACAGAAAAAATGATTGAAAAGTATGAATCACTTGCCTCTGACCTTCTGGAATGGATTGAACAAACCATCATCATTCTGAACAATCGCAAATTTGCCAATTCACTGGTCGGGGTTCAACAGCAGCTTCAGGCATTCAACACTTACCGCACTGTGGAGAAACCACCCAAATTTACTGAGAAGGGGAACTTGGAAGTGCTGCTCTTCACCATTCAGAGCAAGATGAGGGCCAACAACCAGAAGGTCTACATGCCCCGGGAGGGGAAGCTCATCTCTGACATCAACAAGGCCTGGGAAAGACTGGAAAAAGCGGAACACGAAAGAGAACTGGCTTTGCGGAATGAGCTCATAAGACAGGAGAAACTGGAACAGCTCGCCCGCAGATTTGATCGCAAGGCAGCTATGAGGGAGACTTGGCTGAGCGAAAACCAGCGTCTGGTGTCTCAGGACAACTTTGGGTTTGACCTTCCTGCAGTTGAGGCCGCCACAAAAAAGCACGAGGCCATTGAGACAGACATTGCCGCATACGAGGAGCGTGTGCAGGCTGTGGTAGCCGTGGCCAGGGAGCTCGAGGCCGAGAATTACCACGACATCAAGCGCATCACAGCGAGGAAGGACAATGTCATCCGGCTCTGGGAATACCTACTGGAACTGCTCAGGGCCCGGAGACAGCGGCTCGAGATGAACCTGGGGCTGCAGAAGATATTCCAGGAAATGCTCTACATTATGGACTGGATGGATGAAATGAAGGTGCTAGTATTGTCTCAAGACTATGGCAAACACTTACTTGGTGTGGAAGACCTGTTACAGAAGCACACCCTGGTTGAAGCAGACATTGGCATCCAGGCAGAGCGGGTGAGAGGTGTCAATGCCTCCGCCCAGAAGTTCGCAACAGACGGGGAAGGTTACAAGCCCTGTGACCCCCAGGTGATCCGAGACCGCGTGGCCCACATGGAGTTCTGTTATCAAGAGCTTTGCCAGCTGGCGGCTGAGCGCAGGGCCCGTCTGGAAGAGTCCCGCCGCCTCTGGAAGTTCTTCTGGGAGATGGCAGAAGAGGAAGGCTGGATACGGGAGAAGGAGAAGATCCTGTCCTCGGACGATTACGGGAAAGACCTGACCAGCGTCATGCGCCTGCTCAGCAAGCACCGGGCGTTCGAGGACGAGATGAGCGGCCGCAGTGGCCACTTTGAGCAGGCCATCAAGGAAGGCGAAGACATGATCGCGGAGGAGCACTTCGGGTCGGAGAAGATCCGTGAGAGGATCATTTACATCCGGGAGCAGTGGGCCAACCTAGAGCAGCTCTCGGCCATTCGGAAGAAGCGCCTGGAGGAGGCCTCCCTGCTGCACCAGTTCCAGGCAGATGCTGATGACATTGATGCCTGGATGCTGGACATCCTCAAGATTGTCTCCAGCAGCGACGTGGGCCACGATGAGTATTCCACACAGTCTCTGGTCAAGAAACACAAGGACGTGGCGGAAGAGATCGCCAATTACAGGCCCACCCTTGACACGCTGCACGAACAAGCCAGCGCCCTCCCCCAGGAGCATGCCGAGTCTCCAGACGTGAGGGGCAGGCTGTCGGGCATCGAGGAGCGGTATAAGGAGGTGGCAGAGCTGACGCGGCTGCGGAAGCAGGCACTCCAGGACACTCTGGCCCTGTACAAGATGTTCAGCGAGGCTGATGCCTGTGAGCTCTGGATCGACGAGAAGGAGCAGTGGCTCAACAACATGCAGATCCCAGAGAAGCTGGAGGATCTGGAGGTCATCCAGCACAGATTTGAGAGCCTAGAACCAGAAATGAACAACCAGGCTTCCCGGGTTGCAGTGGTGAACCAGATTGCACGCCAGCTGATGCACAGCGGCCACCCAAGTGAGAAGGAAATCAAAGCCCAGCAGGACAAACTCAACACAAGGTGGAGCCAGTTCAGAGAACTGGTTGACAGGAAGAAGGATGCCCTCCTGTCTGCCCTGAGCATCCAGAACTACCACCTCGAGTGCAATGAAACCAAATCCTGGATTCGGGAAAAGACCAAGGTCATCGAGTCCACCCAGGACCTGGGCAATGACCTGGCTGGCGTCATGGCCCTGCAGCGCAAGCTGACCGGCATGGAGCGGGACTTGGTGGCCATTGAGGCAAAGCTGAGTGACCTGCAGAAGGAGGCGGAGAAGCTGG