Transcript asmbl_45032

Sequence
Transcript Sequence for observation asmbl_45032 of TGE0038201:
GTTGTTTCCATTTCTCTTTAAAGTGAAATATTGTGGGGCTGAGATCCCTCGTAGCAACAAAAAGTTTGCTACCATCGTCGAAGGAGGCCATGATGGATTTCTTCAACGCCCAGATGCGCCTGGGGGGGCTGACCCAGGCCCCTGGCAACCCAGTGTTGGCTGTGCAGATTAACCAGGACAAGAATTTTGCCTTTTTGGAGTTCCGCTCAGTGGACGAGACTACCCAGGCTATGGCCTTTGATGGCATCATCTTCCAGGGCCAGTCACTAAAGATCCGCAGGCCTCACGACTACCAGCCGCTTCCTGGCATGTCAGAGAACCCCTCCGTCTATGTGCCTGGGGTTGTGTCCACTGTGGTCCCCGACTCTGCCCACAAGCTGTTCATCGGGGGCTTACCCAACTACCTGAACGATGACCAGGTCAAAGAGCTGCTGACATCCTTTGGGCCCCTCAAGGCCTTCAACCTGGTCAAGGACAGTGCCACGGGGCTCTCCAAGGGCTACGCCTTCTGTGAGTACGTGGACATCAACGTCACGGATCAGGCCATTGCGGGGCTGAACGGCATGCAGCTGGGGGATAAGAAGCTGCTGGTCCAGAGGGCGAGTGTGGGAGCCAAGAATGCCACGCTGAGCACCATCAATCAGACGCCTGTGACCCTGCAAGTGCCGGGCTTGATGAGCTCCCAGGTGCAGATGGGCGGCCACCCGACTGAGGTCCTGTGCCTCATGAACATGGTGCTGCCTGAGGAGCTGCTGGACGACGAGGAGTATGAGGAGATCGTGGAGGACGTGCGGGACGAGTGCAGCAAGTACGGGCTTGTCAAGTCCATCGAGATCCCCCGGCCTGTGGACGGCGTCGAGGTGCCCGGCTGCGGAAAGATCTTTGTGGAGTTCACCTCTGTGTTTGACTGCCAGAAAGCCATGCAGGGCCTGACGGGCCGCAAGTTCGCCAACAGAGTGGTTGTCACAAAATACTGTGACCCCGACTCTTATCACCGCCGGGACTTCTGGTAGAGGCGGCTGGGGGAGGGTGGGGGCAGGGCTGGCTGGGGGCTTCTCCCCACTCCCGCCCCCCCCTTATCCCCCTCTGAAGACGATGGGCAGAGGAGTGACAGCCGCAGACACACGACAGCCGGCAGCAACTGGAATGGCAGCAATTAAGGGTGGGGGGCGGGGGTTGGGG