Transcript asmbl_45031

Sequence
Transcript Sequence for observation asmbl_45031 of TGE0001202:
CGGGGAGGGCTGCCGGAGGCTTGATTAGGTAGGAGGTGGCGAAGCGCCGGCGGCGGCCGGAAGTAGCCGAAGCCAGCGGCGGAAGTAGCCGAAGCGGCTGGAGCGGGCGGCAAGGCGAGGCGAAAGCTGCACAGGGCCCTACGCGGCCGCCTCAGCATGTCGGACTTCGACGAGTTCGAGCGGCAGCTCAACGAGAATAAACAAGAGCGGGACAAGGAGAACCGGCATCGGAAGCGCAGCCACAGCCGCTCTCGGAGCCGGGACCGCAAACGCCGGAGCCGGAGCCGCGACCGGCGCAACCGGGACCAGCGGAGCGCCTCCCGGGACAGGCGACGACGCAGCAAACCTTTGACCAGAGGCGCTAAAGAGGAGCACGGTGGACTGATTCGTTCCCCCCGCCACGAGAAGAAGAAGAAGGTCCGTAAATACTGGGACGTGCCACCCCCAGGCTTTGAGCACATCACCCCAATGCAGTACAAGGCCATGCAAGCTGCGGGTCAGATTCCAGCCACTGCTCTTCTCCCCACCATGACCCCTGACGGTCTGGCTGTGACCCCAACGCCGGTGCCCGTGGTCGGGAGCCAGATGACCAGACAAGCCCGGCGCCTCTACGTGGGCAACATCCCCTTTGGCATCACTGAGGAGGCCATGATGGATTTCTTCAACGCCCAGATGCGCCTGGGGGGGCTGACCCAGGCCCCTGGCAACCCAGTGTTGGCTGTGCAGATTAACCAGGACAAGAATTTTGCCTTTTTGGAGTTCCGCTCAGTGGACGAGACTACCCAGGCTATGGCCTTTGATGGCATCATCTTCCAGGGCCAGTCACTAAAGATCCGCAGGCCTCACGACTACCAGCCGCTTCCTGGCATGTCAGAGAACCCCTCCGTCTATGTGCCTGGGGTTGTGTCCACTGTGGTCCCCGACTCTGCCCACAAGCTGTTCATCGGGGGCTTACCCAACTACCTGAACGATGACCAGGTCAAAGAGCTGCTGACATCCTTTGGGCCCCTCAAGGCCTTCAACCTGGTCAAGGACAGTGCCACGGGGCTCTCCAAGGGCTACGCCTTCTGTGAGTACGTGGACATCAACGTCACGGATCAGGCCATTGCGGGGCTGAACGGCATGCAGCTGGGGGATAAGAAGCTGCTGGTCCAGAGGGCGAGTGTGGGAGCCAAGAATGCCACGCTGGTGAGCCCCCCGAGCACCATCAATCAGACGCCTGTGACCCTGCAAGTGCCGGGCTTGATGAGCTCCCAGGTGCAGATGGGCGGCCACCCGACTGAGGTCCTGTGCCTCATGAACATGGTGCTGCCTGAGGAGCTGCTGGACGACGAGGAGTATGAGGAGATCGTGGAGGACGTGCGGGACGAGTGCAGCAAGTACGGGCTTGTCAAGTCCATCGAGATCCCCCGGCCTGTGGACGGCGTCGAGGTGCCCGGCTGCGGAAAGATCTTTGTGGAGTTCACCTCTGTGTTTGACTGCCAGAAAGCCATGCAGGGCCTGACGGGCCGCAAGTTCGCCAACAGAGTGGTTGTCACAAAATACTGTGACCCCGACTCTTATCACCGCCGGGACTTCTGGTAGAGGCGGCTGGGGGAGGGTGGGGGCAGGGCTGGCTGGGGGCTTCTCCCCACTCCCGCCCCCCCCTTATCCCCCTCTGAAGACGATGGGCAGAGGAGTGACAGCCGCAGACACACGACAGCCGGCAGCAACTGGAATGGCAGCAATTAAGGGTGGGGGGCGGGGGTTGGGG