Transcript asmbl_30878

Sequence
Transcript Sequence for observation asmbl_30878 of TGE0008976:
CGGAAGTGGGAGCCCTTCGGCCACTGAGACTGTCGTGTGTCGTCGCTGCTGGCCCTTCAGGCTCTGCCCCTCCCCCCTAGGTCTGGATGGAGGACACTTTGAAGTGAAATGACAGACCAGGAGAATAACAACAACATCTCAAGTAACCCCTTTGCTGCTCTTTTTGGTTCCCTGGCTGACGCCAAGCAGTTTGCTGCAATCCAAAAAGAGCAGCTGAAGCAGCAATCTGATGAACTCCCAGCTAGCCTGGATGACTCAGATAATAGTGTGTCAGAGAGTCTGGATGAATTTGATTACTCGGTGGCTGAGATTAGCCGCTCATTCCGTTCACATTTATTATGTGAGCAACTCAACATCAATCACATGATCCAAAGGATCTTCCTCATTACTCTGGACAACAGTGACCCAAGCTTGAAAAGTGGGAATGGCATCCCCAGCCGCTGTGTGTATTTAGAAGAAATGGCTGTAGACCTAGAAGATCAAGACTGGCTTGATATGAACAATGTTGAGCAGGCCGTCTTCGCTCGCTTATTACTTCAAGATCCAGGCAACCACTTGATTAACATGACTTCTTCTACAACGTTGAATCTCTCTGCTGATCGAGATGCGGGGGAGAGTCACATTTTTTGTTACCTTTATTCCTGCTTCCAAAGAGCCAAGGAAGAGATTACCAAAGTTCCAGAGAACCTGCTACCTTTTGCAGTTCAGTGCAGGAATCTCACGGTGTCCAATACACGAACAGTTCTCCTCACTCCAGAAATCTATGTTGACCAAAACATCTATGAGCAACTGGTAGATTTGATGTTGGAAGCTATCCAAGGAGCCCATTTTGAAGATGTTACTGAGTTTCTGGAAGAGGTCATTGAAGCCTTGATATTGGACGAAGAAGTGCGAACATTTCCAGAAGTCATGATTCCAGTGTTTGATATTTTATTGGGCCGAATAAAAGATCTAGAACTCTGTCAGATCCTGTTGTATGTATATCTGGATATTCTTCTCTATTTCACTAGGCAAAAGGATATGGCAAAGGTTTTTGTAGAATACATTCAGCCCAAAGACCCTAGCAATGGGCAGATGTACCAGAAGACCTTGCTGGGAATAATCCTGAATATCTCCTGCTTATTAAAGACTCCGGGCATAGTAGAAAATCATGGCTACTTCTTGAATCCATCTCGTTCCAGTCCCCAGGAGATCAAAGTACAAGAGGCCAATATCCATCAGGTTTGGACAAAGAAACCTGTTTGATCCCAGCTGTGCAGGAACCAAAGTTTCCCCAGAACTACAACCTCGTAACAGAGAACCTTGTCCTGACAGAGTATACCTTGTACTTGGGATTTCACAGGTTGCATGATCAGATGGTAAAAATCAACCAAAATCTGCATCGGCTGCAGGTTGCTTGGCGGGATGCTCAGCAGAGTTCTAGTCCTGCTGCTGACAACCTCCGTGAACAGTTTGAACGACTGATGACCATCTATCTTTCTACCAAGACTGCTATGACTGAGCCACAGATGCTACAAAACTGCCTAAATTTGCAGGTGTCCATGGCCGTTCTACTAGTTCAACTGGCCATAGGCAATGAGGGCTCACAGCCGATAGAGCTAACTTTCCCTCTGCCAGATGGCTACAGTTCTTTGGCTTATGTACCAGAATTTTTTGCAGATAACCTAGGCGATTTCCTCATCTTTCTCCGCCGCTTTGCCGATGACATCTTGGAGACATCAGCAGATTCCCTGGAAAATGTTCTTTACTTTATCACCATTTTCACTGGAAGCATAGAAAGGATGAAGAATCCCCACCTCAGAGCCAAACTGGCTGAGGTGTTGGAAGCAGTGATGCCCCACCTGGATCAGACCCCAAATCCCTTGGTATCCAGTGTGTTCCATCGGAAGCGTGTGTTCTGCAACTTTCCCTATGCACCCCACCTTGCAGAAGCACTAATCAAGGTCTTCGTGGACATTGAATTTACAGGAGACCCCCATCAATTTGAACAGAAGTTTAATTATCGCCGTCCCATGTATCCCATCCTAAGGTATATGTGGGGAACAGATACCTATCGAGAAAGCATTAAGGATTTGGCTGACTATGCCTCTAAGAATTTGGAAGCCATGAATCCCCCACTTTTTCTCCGCTTTCTTAACCTGCTAATGAATGATGCCATCTTCCTTTTGGATGAAGCCATACAGTATTTGAGCAAGATAAAGATTCAACAGATTGAGAAGGACCGAGGTGAATGGGATAGTCTGACTCCAGAAGCCCGCCGAGAGAAGGAAGCGGGCCTACAGATGTTTGGACAGCTAGCACGTTTCCATAACATCATGTCCAATGAAACAATTGGTACCCTTGCCTTTCTGACATCAGAGATTAAATCACTCTTCGTGCATCCTTTTCTGGCTGAGCGCATCATTTCAATGCTGAACTACTTCCTGCAGCACCTGGTTGGCCCCAAAATGGGGGCCTTAAAAGTCAAGGACTTCAGTGAATTTGACTTCAAACCCCAACAGCTCGTATCAGATATATGCACTATCTACTTAAATCTTGGGGATGAGGAAAATTTCTGTGCCACGGTGCCCAAGGATGGGCGTTCCTATTCCCCAACTCTCTTTGCACAGACAGTCAGAGTCCTAAAGAAAATAAATAAGCCTGGAAATATGATTGTGGCTTTCAGCAACTTAGCAGAGAGAATCAAGTCTCTAGCAGACCTCCAACAACAGGAAGAGGAGACCTATGCAGATGCCTGTGATGAGTTTCTGGATCCCATCATGAGCACACTGATGTCTGATCCTGTGGTGCTGCCATCTTCCAGAGTCACTGTGGATAGATCCACCATTGCCAGACATTTGCTCAGTGACCAAACAGATCCCTTTAACCGTAGTCCCCTCACCATGGACCAGATCCGGCCAAACACAGAACTAAAAGAAAAAATCCAACGGTGGCTCGCAGAGAGGAAACAACAAAAGGAGCAACTTGAATAAATACTGTGACCTAAGCAAACCAAAAACTAACCCCAGAGTGTAGATAAACAGTTGTTTGTGATTTCTCTCTGGTTCTGTTCCTTTTTGTCTTTCTTTACTAAATTAGAAAACTGCTCTTGCTCAAATTATGATAATTAAGTTTCCTAAGAACTTTACAATTATAGTTATAGCATCACCAAGTTTAGAAATCACTAATTTTTATCCTTTGTTTGCTCTTTTCCTATTCTTCTTCCTTTTCCTACCTTACATTATATTAACTTCAAATACTAAAACTTCCTGCCACCTTACTATTTCTCTTCAGTAACTACTCAAACATCTTTGGTGAGCACTGCTTGTAAGTCTGTGATGTCACCTATTTCAGTGACAGCTGATATCATAAAGTCCTGTGTTATCAAGGTATTTATCAGTCTGCATGACCTGGACTTCAGCTCTTTTCCTTGTTACAGTTCTGCAGTGTTACAGAACAACCTTTTACATAAAAGCAGATACCTTGATGTTTGAGTAGACTTTGAATATGATGATAGTTGAAATGAAAAAAAGGAATCTTACACAATTGTGTTGATAGTTCTTAATTTTAATTATCTCATAACTCAAAAGATACCTTGGAGGACACTCCCATGGGGTTGTCATTACTGCAGAAAACTTAGTTCTGCAATATTTTTAGGGGGATTAACAAGACAAACTTGCAGTTTTGACACTTTATTCAAAAAATTCTGAGGTGAAAGAATAAAGGAGGTTGTTGGACCCTTTTTAGCTTATGGAAATCTGTTGCTTGAGTTGAAAAATTGGGCAACAAATATTGTGAGCAGGAAAAAAATGCTATTTTAAAACATTACTATCAACAGTATATATGTGTGTCTGTATACGTATACACACACACACCATGTGCTTTTTTCATATCGGTCTAGTGTAAACTGCCACTTTATCTCTTTCATGGTAAGATGTATACAGTGTGTGACCACTAACACACTTATTCTAGACAAAATTCTGAGACTATAAAATATATATAGTTAATGTTTGGGCTTTTAACCTTAATTCTAAGAGCTGCTTCTAACTCACTCTTACGTCATCAATTAACAAAGTAGGAATTTGAGCACAACCTTGTCCACAAACCATTTTAAATACCCACTTAGTAGTTAGTAGGTGGCTAGACCCCACTTTTACAAGTTGAGCTTGGGTTCCCTACTCATTTGTTCAGCTTAACATGCTGTTCCACTAAGCCCAAAGATATAAGTGACAAGAAAAGTGGTATGATCTAGAAACAGGGGTCATCGCTTCATTAAGAGGACATTATCATTAACCATGACATCTTTTAAATAAGATGGCAGTTTTGTGATACTCCAAGGTTCTGTAAACATTCCTTGATGTGTTTTTGATGGTATCATCTGGAAAGTCACAAATTAGAGGGCATCCCACACTAGATATAAAGATGTTGCCTATTGCTGTGCATGTAAATGAAAAAAGAAGTCTGTGAATCTTACAGATGCCAGAGAATAAGATATTAATTCAGTGTGCTCCCTGAGCCTTTAAGGCATAGGTTGGGAGAATTTTTTTGTTTTCTTAAAATGAGCTTCATGACATATTTTTTATTCTCCTTTACTTCTCTGAGGATGAACTGTTTATAAACTAAGCTTCTACCTTTTTGGATTTATCTTCCAAACCCAATCTAATAGGATGTTTTCATTTTTAAAAGAAGTGAGGAAAAGACCAGAGTTTTATAGGAGAAAATTAGAGGAGAAATGGCCACGAAACCTCAGAAGGCAAGCTGTTCCCAGCAGCTTTCTAGTTAATAACCTCTATGCTGCCTCTTGTATCTGTGTCTGTATTCTACTTCTGTATTTAGTCTTCAGATTGTAAGCCTTTTCTGGTAAGCTTTTTTTCTTTTAAACCCTTTTCCTGGAACTTTTTATGAATGGCTATGGCACCATTATTGCTGCTGAATATATCTTTAAACTCATCACGAAGGCAAGTGTGTGGCTTAAGGCCACTATTGGTAAGAAACCAAGTGTCCTCTGTGCCTTTTTTCTTTGTTTGAAGTAATTTAAAAACATCCCAAAAATGAGACTAAAAATTTATCATCTTCATAAAACACAATGTGTATATGCACTTAGAAGCTTATAAAGAGGTATTTTGTTATCTTGAACTCAGAAGCAGCCCTAAAGCTATTAGGGCAGACTTCCTGACATTTAGTTTTATGTGTTGGCTTTGCTGGAATATGATAGGAAAATGAAGACTCTAATCAGCTCTAATATTGCTAAGAGGGTAATACTAAACTTGGAAAATTAGGTTTTATCAAGCAATCTGGGTTTGTTTTTTTAATATGGTTTTTTAATGGATATTCAGTAAAAACTGAAAGAAATTTTAAAGGTTTTTTAATAGTGCAAGTGCAAGTGCCAGTTGCTGTTTGGTATCACACTCTACAAAAGCTTCATTACTTTATGTGATACTGGTTGCTAAGCAGCCATTGCACAGAGCAGAAGTCTACTGGGTACCTTTACCAACTAGAGGCTGATGCTGCCCTGTTGATGGAAATAATGCACATGCTCTAACTGCTAAACAGGAAAACACCCTAGAAACAAAGAAAATGAAGAACAACAAAAAGTTTGAATGAAATAAAACTTGATCAACATAGCTGTATTTTGAAACATTCCAGGAAAGTAATTTCTTGTCAAACTCGCCTGGGGGTATTTGGTAAAAGCCTGTATTTAATAAATGAACACCTGACTTACCTTTGTTATCACTTTATTACAATA