Transcript asmbl_26973

Sequence
Transcript Sequence for observation asmbl_26973 of TGE0000952:
CCGGCGGCGGCAGGCGTCGCTGTCTTTTCTCCTTTTCCCCAATATGGCAGCGGCGGACGGCGGCGGGCCTGGTGGGGCCTCTGTGGGGACTGAGGAGGATGGCGGAGGCGTCGGCCACAGGACGGTGTACTTGTTTGATCGGCGCGAAAAGGAGTCCGAGCTCGGGGACCGGCCTCTGCAGGTCGGGGAGCGCTCGGACTACGCGGGATTTCGCGCGTGTGTGTGTCAGACACTTGGCATTTCACCTGAAGAAAAATTTGTTATTACAACAACAAGTAGGAAAGAAATTACCTGTGATAATTTTGATGAAACTGTTAAAGATGGAGTCACCTTATACCTGCTACAGTCGGTCAATCAGTTACTACTGACAGCTACGAAAGAACGAATTGACTTCTTACCTCACTATGACACACTGGTTAAAAGTGGCATGTATGAATATTATGCCAGTGAAGGACAAAATCCTTTGCCATTTGCTCTTGCGGAATTAATTGACAATTCATTGTCTGCTACTTCTCGTAACATTGGGGTTAGAAGAATACAGATCAAATTGCTTTTTGATGAAACACAAGGAAAACCTGCTGTTGCAGTGATAGATAATGGAAGAGGAATGACCTCTAAACAGCTTAACAACTGGGCCGTGTATAGGTTGTCAAAATTCACAAGGCAAGGTGACTTTGAAAGTGATCATTCAGGATATGTTCGTCCAGTACCAGTGCCACGCAGTTTAAATAGTGATATTTCCTATTTTGGTGTTGGGGGCAAGCAAGCTGTCTTCTTTGTTGGACAATCAGCCAGAATGATAAGCAAACCTGCAGATTCCCAAGATGTTCACGAGCTTGTGCTTTCTAAAGAAGATTTTGAGAAGAAGGAGAAAAATAAAGAGGCAATATATAGTGGATATATTAGAAACAGAAAGCCCTCTGATTCTGTTCACATTACAAATGATGATGAAAGATTTCTACATCATCTTATCATAGAGGAGAAGGAAAAAGATAGCTTTACTGCTGTGGTTATCACAGGGGTACAACCAGAACACATACAGTACTTGAAAAATTATTTCCACCTTTGGACACGACAGTTAGCGCATATTTATCACTACTATATTCATGGCCCAAAAGGAAATGAAATACGAACATCAAAAGAAGTTGAACCTTTCAACAATATTGATATTGAAATTTCTATGTTTGAAAAAGGGAAGGTACCTAAGATTGTCAACCTAAGGGAAATACAAGACGACATGCAGACGTTGTATGTAAACACAGCAGCTGATAGTTTTGAATTCAAAGCTCATGTTGAAGGAGATGGTGTAGTGGAAGGGATTATCCGTTATCATCCATTCTTATATGATAGAGAAACTTACCCTGATGATCCATGCTTTCCATCAAAATTAAAAGATGAAGATGATGAAGATGATTGTTTCATACTTGAGAAAGCAGCTAGAGGGAAAAGGCCTATTTTTGAATGTTTTTGGAATGGACGATTAATACCATATACATCAGTTGAAGACTTTGACTGGTGTACTCCTCCTAAGAAGAGAGGGCTTGCACCAATTGAATGCTACAATAGGATATCTGGTGCATTATTCACTAATGACAAATTCCAGGTCAGCACAAATAAATTGACGTTTATGGATCTTGAGCTAAAATTGAAAGATAAGAACACCCTTTTTACAAGGATTTTAAATGGACAGGAACAGCGAATGAAAATTGACAGAGAATTTGCTTTGTGGCTGAAGGACTGTCATGAGAAGTATGATAAACAAATAAAATTTACACTTTTTAAGGGAGTAATTACACGTCCTGATCTTCCTTCTAAAAAGCAAGGTCCCTGGGCAACATATGCAGCAATAGAATGGGATGGAAAGATATACAAAGCAGGACAGCTGGTCAAGACAATCAAGACACTTCCCCTCTTTTATGGAAGCATAGTAAGATTTTTTCTTTATGGCGATCATGATGGAGAAGTATATGCTACAGGAGGAGAGGTTCAAATTGCAATGGAACCTCAGGCACTATATGATGAAGTAAGAACTGTGCCAATTGCAAAGCTGGATAGGACAGTTGCTGAGAAAGCTGTTAAAAAATATGTAGAAGATGAAATGGCAAGGCTCCCTGATAGATTGTCAGTAACTTGGCCTGAAGGAGATGAATTATTGCCTAATGAGGTTAGGCCTGCTGGAACCCCTATTGGTGCGTTAAGAATTGAAATACTGAATAAAAAAGGGGAAGCAATGCAAAAGCTTCCAGGAACAAGCCATGGAGGGTCAAAGAAACTCCTGGTTGAGCTCAAAGTTATTTTACATTCTTCAAGTGGAAATAAAGAGATTATTTCGCATATTAGTCAACATGGAGGAAAATGGCCTTACTGGTTTAAAAAAATGGAAAATATTCAGAAGTTGGGGAATTATACCTTGAAATTACAAGTTGTGTTGAATGAAAGTAATGCAGACACTTATGCAGGAAGACCACTACCATCTAAAGCAATTAAGTTTTCTGTTAAAGAGGGTAAGCCAGAGAAATTTTCATTTGGTCTTCTGGATCTTCCTTTTCGTGTTGGAGTTCCATTTAATATCCCTCTGGAGTTTCAGGATGAATTTGGTCATACCAGTCAACTAGTAACTGATATTCAGCCAGTTCTTGAAGCAAGTGGTTTATCTTTACATTATGAAGAAATAACCAAAGGACCAAATTGTGTAATTCGAGGTGTTACAGCCAAGGGCCCTGTAAACTCTTGTCAAGGCAAGAATTATAATCTGAAGGTTACTCTGCCTGGCTTAAAAGAAGACTCACAGATTTTGAAAATTAGATTACTACCTGGTCACCCTCGTCGACTGAAAGTGAAACCTGATTCTGAAATTTTAGTTATAGAAAATGGAACAGCTTTCCCATTTCAGGTGGAAGTTTTAGATGAATCAGACAACATAACAGCACAACCAAAATTGATTGTTCATTGTAAGTTTTCAGGTGCTCCAAACCTTCCAGTCTATGTTGTAGATTGCAGTAGTTCTGGAACCAGTATTTTAACAGGATCTGCAATTCAAGTTCAGAATATTAAAAAAGACCAGACGCTTAAAGCAAGAATTGAAATACCTAGTTGTAAAGATGTGGCACCTGTGGAGAAGACTATTAAGTTGCTTCCCAGTAGCCATGTTGCAAGACTACAAATATTCAGTGTAGAAGGACAAAAGGCAATTCAGATCAAACATCAGGATGAGGTTAATTGGATAGCGGGTGATATTATGCATAATCTTATTTTTCAAATGTATGATGAAGGAGAAAGAGAAATCAATATAACATCAGCTTTAGCAGAAAAAATTAAAGTTAATTGGACTCCTGAGATTAACAAAGAACACTTGCTACAGGGTCTGCTTCCTGATGTGCAAGTACCAACATCTGTAAAAGATATGCGCTATTGCCAGGTTTCATTCCAAGATGATCATGTGTCTTTGGAAAGTGCGTTTACAGTAAGACCACTTCCTGATGAACCTAAACATTTAAAATGTGAAATGAAAGGAGGAAAAACAGTACAGATGGGCCAAGAGCTTCAAGGAGAAGTAGTTATAATAATTACAGATCAGTACGGAAATCAGATTCAAGCATTTTCACCAAGTTCTTTATCTTCTTTGTCAATTGCTGGGGTTGGACTTGATAGCTCAAATTTGAAAACAACCTTTCAGGAAAACACACAGAGTATAAGTGTAAGAGGCATCAAATTTATTCCAGGTCCTCCTGGAAATAAGGATCTTTGTTTTACTTGGCGTGAGTTTTCTGACTTTATTCGAGTGCAACTAATTTCTGGACCTCCTGCTAAACTTCTCCTTATAGACTGGCCAGAACTAAAGGAGTCCATTCCAGTGATTAATGGAAGAGATTTACAGAACCCTATTATTGTTCAACTTTGTGATCAGTGGGATAATCCAGCACCGGTACAACATGTTAAAATAAGTCTTACAAAAGCTAGCAATTTAAAGCTCATGCCTTCAAACCAACAGCATAAAACAGATGAGAAAGGCAGGGCTAATTTGGGAGTATTCAGTGTTTTTGCCCCTAGGGGAGAGCATACTCTTCAGGTTAAAGCCATCTATAACAAAAGTATCATAGAAGGACCTATAATTAAGTTAATGATTCTTCCAGACCCAGAAAAACCCGTTCGTCTCAATGTTAAATATGACAAAGATGCATCCTTCTTAGCAGGGGGTCTTTTCACTGATTTTATGATTAGTGTTATTTCTGAAGATGACAGTATCATTAAAAACATTAATCCAGCACGTATTTCCATGAAAATGTGGAAGCTGTCTACCAGTGGGAACCGACCCCCAGCAAATGCAGAAACATTTAGTTGTAATAAAATAAAAGATAATGACAAAGAAGATGGCTGCTTCTATTTCAGGGATAAAGTAATTCCTAATAAAGTGGGGACATATTGTATCCAGTTTGGTTTTATGATGGATAAAACAAATATTCTCAACAGTGAACAGGTTATAGTTGAAGTCCTGCCTAATCAACCTGTGAAGTTAGTACCTAAAATTAAACCACCTACACCAGCTGTTTCAAATGTTCGCTCAGTTGCCAGTAGGACCTTGGTCAGAGATCTACATCTTAGTATCACGGATGACTACGACAACCATACTGGAATTGATTTGGTTGGCACTATAATAGCCACCATTAAAGGCTCTAATGAGGAAGATACTGATACCCCACTTTTTATTGGGAAAGTTAGAACACTTGAATTCCCCTTCGTGAATGGTTCGGCTGAAATCATGAGTCTGGTGCTGGCAGAAAGTAGTCCTGGAAGGGATAGTACTGAATATTTTATTGTATTTGAGCCCCGGCTACCACTTTTATCAAGAACCTTAGAACCATATATCCTACCGTTCATGTTTTACAATGATGTTAAGAAGCAGCAACAAATGGCAGCACTTACAAAAGAAAAGGACCAATTATCTCAGTCTATTGTTATGTATAAAAGTTTATTTGAAGCCAGCCAACAGCTTCTTAATGAAATGAAATGTCAAGTTGAAGAAGCAAGATTAAAAGAGGCCCAATTGCGAAATGAACTAAAAATACATAATATTGACATTCCTACAACACAACAGGTGCCACACATTGAAGCACTTCTGAAAAGAAAGCTATCAGAACAAGAAGAACTGAAGAAAAAACCTAGAAGATCGTGTACTCTTCCAAACTATACTAAAGGCAGTGGAGATGTTTTGGGAAAGATTGCACATCTAGCACAAATTGAAGATGATAGAGCTGCGATGGTTATTTCTTGGCATCTGGCAAGTGACATGGACTGTGTAGTCACCCTAACCACTGACGCTGCACGTCGTATCTATGATGAAACCCAAGGTCGTCAGCAGGTGTTG