Transcript asmbl_43824

Sequence
Transcript Sequence for observation asmbl_43824 of TGE0060435:
CTCGGAGCCGTTGGGTCGGTTCCTGCTATTCCGGCGCCTCCACTCCGTCCCCCGCGGGTCTGCTCTGTGTGCCATGGACGGCATTGTCCCAGATATAGCCGTTGGTACAAAGCGGGGATCTGACGAGCTTTTCTCTACTTGTGTCACTAACGGACCGTTTATCATGAGCAGCAACTCGGCTTCTGCAGCAAACGGAAATGACAGCAAGAAGTTCAAAGGTGACAGCCGAAGTGCAGGCGTCCCCTCTAGAGTGATCCACATCCGGAAGCTCCCCATCGACGTCACGGAGGGGGAAGTCATCTCCCTGGGGCTGCCCTTTGGGAAGGTCACCAACCTCCTGATGCTGAAGGGGAAAAACCAGGCCTTCATCGAGATGAACACGGAGGAGGCTGCCAACACCATGGTGAACTACTACACCTCGGTGACCCCTGTGCTGCGCGGCCAGCCCATCTACATCCAGTTCTCCAACCACAAGGAGCTGAAGACCGACAGCTCTCCCAACCAGGCGCGGGCCCAGGCGGCCCTGCAGGCGGTGAACTCGGTCCAGTCGGGGAACCTGGCCTTGGCTGCCTCGGCGGCGGCCGTGGACGCAGGGATGGCGATGGCCGGGCAGAGCCCCGTGCTCAGGATCATCGTGGAGAACCTCTTCTACCCTGTGACCCTGGATGTGCTGCACCAGATTTTCTCCAAGTTCGGCACAGTGTTGAAGATCATCACCTTCACCAAGAACAACCAGTTCCAGGCCCTGCTGCAGTATGCGGACCCCGTGAGCGCCCAGCACGCCAAGCTGTCGCTGGACGGGCAGAACATCTACAACGCCTGCTGCACGCTGCGCATCGACTTTTCCAAGCTCACCAGCCTCAACGTCAAGTACAACAATGACAAGAGCCGTGACTACACACGCCCAGACCTGCCTTCCGGGGACAGCCAGCCCTCGCTGGACCAGACCATGGCCGCGGCCTTCGGTGCACCTGGTATAATCTCAGCCTCTCCGTATGCAGGAGCTGGTTTCCCTCCCACCTTTGCCATTCCTCAAGCTGCAGGCCTTTCCGTTCCGAACGTCCACGGCGCCCTGGCCCCCCTGGCCATCCCCTCGGCGGCGGCGGCAGCTGCGGCGGCAGGTCGGATCGCCATCCCGGGCCTGGCGGGGGCAGGAAATTCTGTATTGCTGGTCAGCAACCTCAACCCAGAGAGAGTCACACCCCAAAGCCTCTTTATTCTTTTCGGCGTCTACGGTGACGTGCAGCGCGTGAAGATCCTGTTCAATAAGAAGGAGAACGCCCTAGTGCAGATGGCGGACGGCAACCAGGCCCAGCTGGCCATGAGCCACCTGAACGGGCACAAGCTGCACGGGAAGCCCATCCGCATCACGCTCTCGAAGCACCAGAACGTGCAGCTGCCCCGCGAGGGCCAGGAGGACCAGGGCCTGACCAAGGACTACGGCAACTCACCCCTGCACCGCTTCAAGAAGCCGGGCTCCAAGAACTTCCAGAACATATTCCCGCCCTCGGCCACGCTGCACCTCTCCAACATCCCGCCCTCAGTCTCCGAGGAGGATCTCAAGGTCCTGTTTTCCAGCAATGGGGGCGTCGTCAAAGGATTCAAGTTCTTCCAGAAGGACCGCAAGATGGCACTGATCCAGATGGGCTCCGTGGAGGAGGCGGTCCAGGCCCTCATTGACCTGCACAACCACGACCTCGGGGAGAACCACCACCTGCGGGTCTCCTTCTCCAAGTCCACCATCTAGGGGCACAGGCCCCCACGGCCGGGCCCCCTGGCGACAACTTCCATCATTCCAGAGAAAAGCCACTTTAAAAACAGCTGAAGTGACCTTAGCAGACCAGAGATTTTATTTTTTTAAAGAGAAATCAGTTTACCTGTTTTTAAAAAAATTAAATCTAGTTCACCTTGCTCACCCTGCGGTGACAGGGACAGCTCAGGCTCTTGGTGACTGTGGCAGCGGGAGTTCCCGGCCCTCCACACCCGGGGCCAGACCCTCGGGGCCATGCCTTGGTGGGGCCTGTGTCGGGCGTGGGGCCTGCAGGTGGGCGCCCCGACCACGACTTGGCTTCCTTGTGCCTTAAAAAACCTGCCTTCCTGCAGCCACACACCCACCCGGGGTGTCCTGGGGACCCAAGGGGTGGGGGGGTCACACCAGAGAGAGGCAGGGGGCCTGGCCGGCTCCTGCAGGATCATGCAGCTGGGGCGCGGCGGCCGCGGCTGCGACACCCCAACCCCAGCCCTCTAATCAAGTCACGTGATTCTCCCTTCACCCCGCCCCCAGGGCCTTCCCTTCTGCCCCCAGGCGGGCTCCCCGCTGCTCCAGCTGCGGAGCTGGTCGACATAATCTCTGTATTATATACTTTGCAGTTGCAGACGTCTGTGCCTAGCAATATTTCCAGTTGACCAAATATTCTAATCTTTTTTCATTTATATGCAAAAGAAATAGTTTTAAGTAACTTTTTATAGCAAGATGATACAATGGTATGAGTGTAATCTAAACTTCCTTGTGGTATTACCTTGTATGCTGTTACTTTTATTTTATTCCTTGTAATTAAGTCACAGGCAGGACCCAGTTTCCAGAGAGCAGGCGGGGCCGCCCAGTGGGTCAGGCACAGGGAGCCCCGGTCCTATCTTAGAGCCCCTGAGCTTCAGGGAAGGGGCGGGCGTGTCGCCGCCTCTGGCATCGCCTCCGGTTGCCTTACACCACGCCTTCACCTGCAGTCGCCTAGAAAACTTGCTCTCAAACTTCAGGGTTTTTTCTTCCTTCAAATTTTGGACCAAAGTCTCATTTCTGTGTTTTGCCTGCCTCTGATGCTGGGACCCGGAAGGCGGGCGCTCCTCCTGTCTTCTCTGTGCTCTTTCTACCGCCCCCGCGTCCTGTCCCGGGGGCTCTCCTAGGATCCCCTTTCCGTAAAAGCGTGTAACAAGGGTGTAAATATTTATAATTTTTTATACCTGTTGTGAGACCCGAGGGGCGGCGGCGCGGTTTTTTATGGTGACACAAATGTATATTTTGCTAACAGCAATTCCAGGCTCAGTATTGTGACCGCGGAGCCACAGGGGACCCCACGCACATTCCGTTGCCTTACCCGATGGCTTGTGACGCGGAGAGAACCGATTAAAACCGTTTGAGAAACTCCTCCCTTGTCTAGCCCTGTGTTCGCTGTGGACGCTGTAGAGGCAGGTTGGCCAGTCTGTACCTGGACTTCGAATAAATCTTCTGTATCCTCG