Transcript asmbl_42866

Sequence
Transcript Sequence for observation asmbl_42866 of TGE0001028:
GCCGGGCATAAAAGGCTTCGCGGCCCAGGGCTCACTTGGCGCTGAGAACGCGGGTCCACGCGTGTGATCGTCCGTGCGTCTAGCCTTTGCCCACGCAGCTTTCAGTCATGGCCTCCGGTAACGCGCGCATCGGAAAGCCAGCCCCTGACTTCAAGGCCACAGCGGTGGTTGATGGCGCCTTCAAAGAGGTGAAGCTGTCGGACTACAAAGGGAAGTACGTGGTCCTCTTTTTCTACCCTCTGGACTTCACTTTTGTGTGCCCCACCGAGATCATCGCGTTCAGCAACCGTGCAGAGGACTTCCGCAAGCTGGGCTGTGAAGTGCTGGGCGTCTCGGTGGACTCTCAGTTCACCCACCTGGCTTGGATCAACACCCCCCGGAAAGAGGGAGGCTTGGGCCCCCTGAACATCCCCCTGCTTGCTGACGTGACCAGACGCTTGTCTGAGGATTACGGCGTGCTGAAAACAGATGAGGGCATTGCCTACAGGGGCCTCTTTATCATCGATGGCAAGGGTGTCCTTCGCCAGATCACTGTTAATGATTTGCCTGTGGGACGCTCCGTGGATGAGGCTCTGCGGCTGGTCCAGGCCTTCCAGTACACAGACGAGCATGGGGAAGTTTGTCCCGCTGGCTGGAAGCCTGGCAGTGACACGATTAAGCCCAACGTGGATGACAGCAAGGAATATTTCTCCAAACACAATTAGGCTGGCTAACGGATAGTGAGCTTGTGCCCCTGCCTAGGTGCCTGTGCTGGGTGTCCACCTGTGCCCCCACCTGGGTGCCCTATGCTGACCCAGGAAAGGCCAGACCTGCCCCTCCAAACTCCACAGTATGGGACCCTGGAGGGCTAGGCCAAGGCCTTCTCATGCCTCCACCTAGAAGCTGAATAGTGACGCCCTCCCCCAAGCCCACCCAGCCGCACACAGGCCTAGAGGTAACCAATAAAGTATTAGGGAAAGGTG