Transcript asmbl_40191

Sequence
Transcript Sequence for observation asmbl_40191 of TGE0057043:
GTTTCTCCTCGGGGTCGGAGCAGGAGGCACGCGGAGTGTGAGGCCACGCATGAGCGGACGCTAACCCCCTCCCCAGCCACAAAGAGTCTACATGTCTAGGGTCTAGACATGTTCAGCTTTGTGGACCTCCGGCTCCTGCTCCTCTTAGCGGCCACCGCCCTCCTGACGCACGGCCAAGAGGAAGGCCAAGTCGAGGGCCAAGACGAAGACATCCCACCAATCACCTGCGTACAGAACGGCCTCAGGTACCATGACCGAGACGTGTGGAAACCCGAGCCCTGCCGGATCTGCGTCTGCGACAACGGCAAGGTGTTGTGCGATGACGTGATCTGTGACGAGACCAAGAACTGCCCCGGCGCCGAAGTCCCCGAGGGCGAGTGCTGTCCCGTCTGCCCCGACGGCTCAGAGTCACCCACCGACCAAGAAACCACCGGCGTCGAGGGACCCAAGGGAGACACTGGCCCCCGAGGCCCAAGGGGACCCGCAGGCCCCCCTGGCCGAGATGGCATCCCTGGACAGCCTGGACTTCCCGGACCCCCCGGACCCCCCGGACCTCCCGGACCCCCTGGCCTCGGAGGAAACTTTGCTCCCCAGCTGTCTTATGGCTATGATGAGAAATCAACCGGAGGAATTTCCGTGCCTGGCCCCATGGGTCCCTCTGGTCCTCGTGGTCTCCCTGGCCCCCCTGGTGCACCTGGTCCCCAAGGCTTCCAAGGTCCCCCTGGTGAGCCTGGCGAGCCTGGAGCTTCAGGTCCCATGGGTCCCCGAGGTCCCCCAGGTCCCCCTGGAAAGAATGGAGATGATGGGGAAGCTGGAAAACCTGGTCGTCCTGGTGAGCGTGGGCCTCCTGGGCCTCAGGGTGCTCGAGGATTGCCCGGAACAGCTGGCCTCCCTGGAATGAAGGGACACAGAGGTTTCAGTGGTTTGGATGGTGCCAAGGGAGATGCTGGTCCTGCTGGTCCTAAGGGTGAGCCTGGCAGCCCTGGTGAAAATGGAGCTCCTGGTCAGATGGGCCCCCGTGGCCTGCCTGGTGAGAGAGGTCGCCCTGGAGCCCCTGGCCCTGCTGGTGCTCGTGGAAATGATGGTGCTACTGGTGCTGCCGGGCCCCCTGGTCCCACCGGCCCCGCTGGTCCTCCTGGCTTCCCTGGTGCTGTTGGTGCTAAGGGTGAAGCTGGTCCCCAAGGGCCCCGAGGCTCTGAAGGTCCCCAGGGTGTGCGTGGTGAGCCTGGCCCCCCTGGCCCTGCTGGTGCTGCTGGCCCTGCTGGAAACCCTGGTGCTGATGGACAGCCTGGTGCTAAAGGTGCCAATGGTGCTCCTGGTATTGCTGGTGCTCCTGGCTTCCCTGGTGCCCGAGGCCCCTCTGGACCCCAGGGCCCCGGCGGCCCTCCTGGTCCCAAGGGTAACAGCGGTGAACCTGGTGCTCCTGGCAGCAAAGGAGACACTGGTGCTAAGGGAGAGCCTGGCCCTGTTGGTGTTCAAGGACCCCCTGGCCCTGCTGGAGAGGAAGGAAAGCGAGGAGCTCGAGGTGAACCCGGACCCACTGGCCTGCCCGGACCCCCTGGCGAGCGTGGTGGACCTGGTAGCCGTGGTTTCCCTGGCGCAGATGGTGTTGCTGGTCCCAAGGGTCCCGCTGGTGAACGTGGTTCTCCTGGCCCTGCTGGCCCCAAAGGATCTCCTGGTGAAGCTGGTCGTCCCGGTGAAGCTGGTCTGCCTGGTGCCAAGGGTCTGACTGGAAGCCCTGGCAGCCCTGGTCCTGATGGCAAAACTGGCCCCCCTGTAAGTATCACTCCCCCTGAACCCCCTGCCATTGTCCTGTCTGCCTCCCTGCTGTCCTCACTGCTGCTTTCGTGCCTCCCATCCTTAGGGTCCCGCCGGTCAAGATGGTCGCCCCGGACCCCCAGGCCCACCTGGTGCCCGTGGTCAGGCTGGTGTGATGGGATTCCCTGGACCTAAAGGTGCTGCTGGAGAGCCCGGCAAGGCTGGAGAGCGAGGTGTTCCCGGACCCCCTGGCGCTGTCGGTCCTGCTGGCAAAGATGGAGAGGCTGGAGCTCAGGGACCCCCTGGCCCTGCTGGTCCCGCTGGCGAGAGAGGTGAACAAGGCCCTGCTGGCTCCCCCGGATTCCAGGGTCTCCCTGGTCCTGCTGGTCCTCCAGGTGAAGCAGGCAAACCTGGTGAACAGGGTGTTCCTGGAGACCTTGGCGCCCCTGGCCCCTCTGGAGCAAGAGGCGAGAGAGGTTTCCCTGGCGAGCGTGGTGTGCAAGGTCCCCCTGGTCCTGCTGGTCCCCGAGGGGCCAACGGTGCTCCCGGCAACGATGGTGCTAAGGGTGATGCTGGTGCCCCTGGAGCTCCCGGTAGCCAGGGCGCCCCTGGCCTTCAGGGAATGCCTGGTGAACGTGGTGCAGCTGGTCTTCCAGGGCCTAAGGGTGACAGAGGTGATGCTGGTCCCAAAGGTGCTGATGGCTCTCCTGGCAAAGATGGCGTCCGTGGTCTGACTGGCCCCATTGGTCCTCCTGGCCCTGCTGGTGCCCCTGGTGACAAGGGTGAAAGTGGTCCCAGCGGCCCTGCTGGTCCCACTGGAGCTCGTGGTGCCCCCGGAGACCGTGGTGAGCCTGGTCCCCCCGGCCCTGCTGGCTTTGCTGGCCCCCCTGGTGCTGACGGCCAACCTGGTGCTAAAGGCGAACCTGGTGATGCTGGTGCTAAAGGCGATGCTGGTCCCCCTGGCCCTGCCGGACCCGCTGGACCCCCTGGCCCCATTGGTAATGTTGGTGCTCCTGGAGCCAAAGGTGCTCGCGGCAGCGCTGGTCCCCCTGGTGCTACTGGTTTCCCTGGTGCTGCTGGCCGAGTCGGTCCTCCTGGCCCCTCTGGAAATGCTGGACCCCCTGGCCCTCCTGGTCCTGCTGGCAAAGAAGGCGGCAAAGGTCCCCGTGGTGAGACTGGCCCTGCTGGACGTCCTGGTGAAGTTGGTCCCCCTGGTCCCCCTGGCCCTGCTGGCGAGAAAGGATCCCCTGGTGCTGATGGTCCTGCTGGTGCTCCTGGTACTCCCGGGCCTCAAGGTATTGCTGGACAGCGTGGTGTGGTCGGCCTGCCTGGTCAGAGAGGAGAGAGAGGCTTCCCTGGTCTTCCTGGCCCCTCTGGTGAACCTGGCAAACAAGGTCCCTCTGGAGCAAGTGGTGAACGTGGTCCCCCTGGTCCCATGGGCCCCCCTGGATTGGCTGGACCCCCTGGTGAATCTGGACGTGAGGGGGCTCCTGGTGCCGAAGGTTCCCCTGGACGAGACGGTTCTCCTGGCGCCAAGGGTGACCGTGGTGAGACCGGCCCCGCTGGACCCCCTGGTGCTCCTGGTGCTCCTGGTGCCCCTGGCCCCGTTGGCCCTGCTGGCAAGAGTGGTGATCGTGGTGAGACTGGTCCTGCTGGTCCCGCCGGTCCTGTCGGCCCTGTTGGCGCCCGTGGCCCCGCCGGACCCCAAGGCCCCCGTGGTGACAAGGGTGAGACAGGCGAACAGGGCGACAGAGGCATAAAGGGTCACCGTGGCTTCTCTGGCCTCCAGGGTCCCCCTGGCCCTCCTGGCTCTCCTGGTGAACAAGGTCCCTCTGGAGCCTCTGGTCCTGCTGGTCCCCGAGGTCCCCCTGGCTCTGCTGGTGCTCCTGGCAAAGATGGACTCAACGGTCTCCCTGGCCCCATTGGGCCCCCTGGTCCTCGCGGTCGCACTGGTGATGCTGGTCCTGTTGGTCCCCCCGGCCCTCCTGGACCTCCTGGTCCCCCTGGTCCTCCCAGCGCTGGTTTCGACTTCAGCTTCCTGCCCCAGCCACCTCAAGAGAAGGCTCACGATGGTGGCCGCTACTACCGGGCTGATGATGCCAATGTGGTTCGTGACCGTGACCTCGAGGTGGACACCACCCTCAAGAGCCTGAGCCAGCAGATCGAGAACATCCGGAGCCCAGAGGGCAGCCGCAAGAACCCCGCCCGCACCTGCCGTGACCTCAAGATGTGCCACTCTGACTGGAAGAGTGGAGAGTACTGGATTGACCCCAACCAAGGCTGCAACCTGGATGCCATCAAAGTCTTCTGCAACATGGAGACTGGTGAGACCTGCGTGTACCCCACTCAGCCCAGTGTGGCCCAGAAGAACTGGTACATCAGCAAGAACCCCAAGGACAAGAGGCATGTCTGGTTCGGCGAGAGCATGACCGATGGATTCCAGTTCGAGTATGGCGGCCAGGGCTCCGACCCTGCCGATGTGGCCATCCAGCTGACCTTCCTGCGCCTGATGTCCACCGAGGCCTCCCAGAACATCACCTACCACTGCAAGAACAGCGTGGCCTACATGGACCAGCAGACTGGCAACCTCAAGAAGGCCCTGCTCCTCCAGGGCTCCAACGAGATCGAGATCCGCGCCGAGGGCAACAGCCGCTTCACCTACAGCGTCACTGTCGATGGCTGCACGAGTCACACCGGAGCCTGGGGCAAGACAGTGATTGAATACAAAACCACCAAGACCTCCCGCCTGCCCATCATCGATGTGGCCCCCTTGGACGTTGGTGCCCCAGACCAGGAATTCGGCTTCGACGTTGGCCCTGTCTGCTTCCTGTAAACTCCCTCCATCCCAACCTGGCTCCCTCCCACCCAACCAACTTTCCCCCCAACCCGGAAACAGACAAGCAACCCAAACTGAACCCCCTCAAAAGCCAAAAAATGGGAGACAATTTCACATGGACTTTGGAAAATATTTTTTTCCTTTGCATTCATCTCTCAAACTTAGTTTTTATCTTTGACCAACCGAACATGACCAAAAACCAAAAGTGCATTCAACCTTACC