Transcript asmbl_38498

Sequence
Transcript Sequence for observation asmbl_38498 of TGE0060383:
GGAACGAGCATTGGAGACCCTTTTCACAAGATGGCGCCGAAAGCGAAGAAGGAAGCTCCTGCCCCTCCTAAAGCTGAAGCCAAAGCGAAGGCTTTAAAGGCCAAGAAGGCAGTGTTGAAAGGTGTCCACAGCCACAAAAAGAAGAAGATCCGCACGTCACCCACCTTCCGGCGGCCGAAGACACTGCGACTCCGGAGACAGCCCAAATATCCTCGGAAGAGCGCTCCCAGGAGAAACAAGCTTGACCACTATGCTATCATCAAGTTTCCGCTGACCACTGAGTCTGCCATGAAGAAGATAGAAGACAACAACACACTTGTGTTCATTGTGGATGTTAAAGCCAACAAGCACCAGATTAAACAGGCTGTGAAGAAGCTGTATGACATTGATGTGGCCAAGGTCAACACCCTGATTCGGCCTGATGGAGAGAAGAAGGCATATGTTCGACTGGCTCCTGATTACGATGCTTTGGATGTTGCCAACAAAATTGGGATCATCTAAACTGAGTCCAGCTGCCTAATTCTGAATATATATATATATATATCTTTTCACCATATACATGCCTGTCTGTCAATTTCTGGTTGGGCTGGGAGGCCACACACACACACTGACATGACAGGGCTTGGGCAAGACTCCTGTTCTACTTATCCTTTTGAAATACCTCACCCTGCCACTCCACCATGTATGATCATTCCAGAGATCTTTGTGACTAGAGTTAGTGTCCTAGGAAAACCAGAACTCAGAACTTGCCTCCATGGTTGAGTAACAAGCTGTACAAGAACCCCTTTTATCCCTGGAAGAGGCTGTGTATGAAACCAATGCCCAGGGTTTGAAGGGTGTTAGCATCCATTTCAGGGGAGTGTGGATTGGCTGGCTCTCTGGTAGCATTTTGTCCTCACACACCCATCTACTATGTCCAACCGGTCTGTCTGCTTCCCTCACCCCTTGCCCAATAAAGGACAAGGACTTCAGAGGA