Transcript asmbl_31797

Sequence
Transcript Sequence for observation asmbl_31797 of TGE0000584:
CCACCATCTTGCTTTCCTTTAATCCGGCAGTGACCGTGTGTCAGAACAATCTTGAATCATGAAGCTACTAACCAGAGCCGGCTCTTTCTCGAGATTTTATTCCCTCAAAGTTGCCCCCAAAGTTAAAGCCACAGCTGCGCCTGCAGGAGCACCGCCACAACCTCAGGACCTTGAGTTTACCAAGTTACCAAATGGCTTGGTGATTGCTTCTTTGGAAAACTATTCTCCTGTATCAAGAATTGGTTTGTTCATTAAAGCAGGCAGTAGATATGAGGACTTCAGCAATTTAGGAACCACCCATTTGCTGCGTCTTACATCCAGTCTGACGACAAAAGGAGCTTCATCTTTCAAGATAACCCGTGGAATTGAAGCAGTTGGTGGCAAATTAAGTGTGACCGCAACAAGGGAAAACATGGCTTATACTGTGGAATGCCTGCGGGGTGATGTTGATATTCTAATGGAGTTCCTGCTCAATGTCACCACAGCACCAGAATTTCGTCGTTGGGAAGTAGCTGACCTTCAGCCTCAGCTAAAGATTGACAAAGCTGTGGCCTTTCAGAATCCGCAGACTCATGTCATTGAAAATTTGCATGCAGCAGCTTACCGGAATGCCTTGGCTAATCCCTTGTATTGTCCTGACTATAGGATTGGAAAAGTGACATCAGAGGAGTTACATTACTTCGTTCAGAACCATTTCACAAGTGCAAGAATGGCTTTGATTGGACTTGGTGTGAGTCATCCTGTTCTAAAGCAAGTTGCTGAACAGTTTCTCAACATGAGGGGTGGGCTTGGTTTATCTGGTGCAAAGGCCAACTACCGTGGAGGTGAAATCCGAGAACAGAATGGAGACAGTCTTGTCCATGCTGCTTTTGTAGCAGAAAGTGCTGTCGCGGGAAGTGCAGAGGCAAATGCATTTAGTGTTCTTCAGCATGTCCTCGGTGCTGGGCCACATGTCAAGAGGGGCAGCAACACCACCAGCCATCTGCACCAGGCTGTTGCCAAGGCAACTCAGCAGCCATTTGATGTTTCTGCATTTAATGCCAGTTACTCAGATTCTGGACTCTTTGGGATTTATACTATCTCCCAGGCCACAGCTGCTGGAGATGTTATCAAGGCTGCCTATAATCAAGTAAAAACAATAGCTCAAGGAAACCTTTCCAACACAGATGTCCAAGCTGCCAAGAACAAGCTGAAAGCTGGATACCTAATGTCAGTGGAGTCTTCTGAGTGTTTCCTGGAAGAAGTCGGGTCCCAGGCTCTAGTTGCTGGTTCTTACATGCCACCATCCACAGTCCTTCAGCAGATTGATTCAGTGGCTAATGCTGATATCATAAATGCGGCAAAGAAGTTTGTTTCTGGCCAGAAGTCAATGGCAGCAAGTGGAAATTTGGGACATACACCTTTTGTTGATGAGTTGTAATACTGATGCACACATTACAGGAGAGAGCTGAACGTTCTCTCAGCCCAGAGCAGCAAACACATGAAAGTCAGAAGTCTCTAATATATCATTTGTCTTTTTTCCAGTGAGGTAAAATAAGGCATAAATGCAGGTAATTATTCCCAGCTGACCTAAAGTCAATAAAACATTCTGTTTAAGTGTTTTTCTTACGTTTTTCTCAATGAGTTAATCAACAAGTATTTATTATGTGCTGATATCTTTGTTTTAGATGCTTTAAAGGAGACAGGAATATAATTATTGAGTATAGAAGCATCAGAAACTATTAAAATTAAGGCTAAGTGGCTATCGGGGTAAATAGTGCCAGATTACTATTGGTGGCGTTTAAGATGAAAGCAAGTTCAAAATTTGTCATTTTGGGTGTCAACAGCTAAATGGTCTGGTTTTTACCCCTGTTTTGCCTTTTTTGCAATAAAATTATTTCCAAAAAAC