Transcript asmbl_30672

Sequence
Transcript Sequence for observation asmbl_30672 of TGE0004781:
GAGACGCAGGCAGCTGACATTGTCTTCTTCGCGCGACTCTTTCTGCAGTCTGGAGAGTCCTCGGCCTCCTGTGCACAATGGCAACTCTTAAGGAAAAACTGATTGCACCAGTTGCAGAAGAGGCAGCGGTCCCAAACAATAAGATCACTGTAGTGGGTGTTGGACAAGTCGGTATGGCGTGTGCCATCAGCATTCTGGGAAAGTCTCTGGCAGATGAGCTTGCTCTTGTGGATGTTTTGGAAGATAAACTCAAAGGAGAAATGATGGATCTGCAGCATGGGAGCTTATTTCTTCAGACACCTAAAATTGTGGCAGATAAAGATTACTCTGTGACTGCCAATTCTAAGGTGGTGGTGGTAACTGCAGGAGTCCGCCAGCAAGAGGGAGAGAGTCGTCTCAATCTGGTACAGAGGAATGTTAATGTCTTCAAATTCATTATTCCGCAGATCATCAAGTACAGTCCTGACTGCATCATAATTGTGGTTTCTAACCCAGTGGATATTCTCACATATGTTACCTGGAAACTAAGTGGATTACCCAAGCACCGTGTGATTGGAAGTGGATGTAATCTGGATTCTGCTAGGTTTCGTTATCTTATGGCTGAAAAACTTGGCATTCATCCCAGCAGCTGCCATGGATGGATTTTGGGAGAACATGGCGACTCAAGTGTGGCTGTGTGGAGCGGAGTGAATGTGGCAGGTGTTTCTCTCCAGGAACTGAATCCAGAAATGGGAACGGACAATGATAGTGAAAATTGGAAGGAAGTGCATAAGATGGTGGTTGAAAGTGCTTATGAAGTCATCAAGCTAAAAGGATACACCAACTGGGCTATTGGATTAAGTGTGGCTGATCTTATTGAATCCATGTTGAAAAATCTATCCAGGATTCATCCAGTGTCAACTATGGTGAAGGGGATGTATGGCATTGAGAATGAAGTCTTCCTGAGCCTTCCATGTATCCTGAATGCTCGGGGATTGACCAGTGTTATCAACCAGAAACTGAAGGATGATGAGGTTGCCCAACTCAAGAAGAGTGCAGATACCCTGTGGGATATCCAGAAGGACCTCAAAGACCTGTGACTTCAGGCTTCTCGGCTGTAGAAATTTAAAAACTACAATGCAATTAACCATGAGCCTTTAGTTTCCAATTATGTACATGGATCACAGTTTGCTTTTATCTCCCTAAGTATGTGAATCTGGGCTCACAGAATCAAAGCCCATGCTTGATTTAATGCTTGCAATATGAGTCCTTGAACAAATAAAATTAACTATCATAGTGTG