Transcript asmbl_27651

Sequence
Transcript Sequence for observation asmbl_27651 of TGE0000435:
GGTGGCGCCACCCCTGATTGCGGTGCCACGGACTGCTCCTGCTGGGCGGAGAGGACAGATTTTGCAAAGCGGAGGCTGCGACGGGTCCTGCAGGGGGACAGTGAGGAAAGGGCCGCCTCGTCTCCGCTCCTGGGGGACCGCAGAAATAAGAATCAAACTCCACAATGACAACCTATTTGGAATTCATTCAACAAAATGAAGAACGAGATGGAGTCCGATTTAGTTGGAATGTTTGGCCATCAAGTCGACTGGAAGCTACAAGAATGGTTGTTCCTGTGGCAGCCCTGTTTACACCACTGAAAGAGAGACCTGACTTACCACCTATTCAATATGAACCTGTTCTGTGTAGTAGGACCACTTGCCGTGCAGTTTTGAATCCTTTATGTCAAGTGGATTATCGAGCAAAACTTTGGGCTTGCAACTTTTGTTACCAAAGGAATCAGTTTCCACCTAGTTATGCTGGTATATCTGAACTGAATCAGCCTGCTGAACTTTTACCTCAGTTTTCTAGCATTGAATATGTAGTTCTGCGTGGTCCTCAGATGCCTTTGATATTCCTCTATGTGGTTGATACTTGCATGGAAGATGAAGATTTACAAGCCCTGAAAGAATCCATGCAGATGTCATTAAGTCTTTTACCACCTACAGCTTTGGTTGGACTTATTACTTTTGGGAGAATGGTTCAGGTTCATGAACTTGGATGTGAAGGCATTTCAAAAAGCTATGTCTTCAGAGGAACAAAAGATTTGTCTGCCAAACAACTGCAGGAAATGCTGGGGCTCTCTAAAGTACCACTTACTCAAGCAACACGTGGTCCTCAGGTACAGCAGCCACCTCCTTCCAACAGATTCTTACAACCAGTACAGAAAATAGACATGAATCTCACAGATCTTCTGGGAGAACTCCAGCGAGACCCTTGGCCTGTACCACAGGGAAAGAGACCTTTGCGTTCCTCTGGGGTGGCACTTTCCATAGCTGTAGGACTGCTGGAGTGTACTTTTCCCAACACTGGTGCTCGTATCATGATGTTCATTGGTGGTCCTGCTACTCAGGGGCCTGGAATGGTGGTTGGAGATGAGTTGAAGACACCTATAAGATCGTGGCATGACATTGACAAAGACAATGCCAAATATGTTAAAAAGGGAACTAAGCATTTTGAAGCATTGGCTAATCGAGCTGCTACAACTGGCCATGTTATTGATATCTATGCGTGTGCATTAGATCAGACAGGTCTCCTGGAGATGAAATGCTGTCCCAACCTTACTGGAGGATACATGGTAATGGGTGATTCTTTCAATACTTCCTTATTCAAACAAACTTTTCAAAGAGTCTTTACCAAAGACATGCATGGACAGTTTAAAATGGGCTTTGGTGGTACGCTAGAAATAAAGACCTCAAGGGAAATAAAGATTTCAGGAGCTATTGGACCCTGTGTGTCACTCAATTCTAAAGGACCCTGTGTGTCTGAAAATGAGATAGGAACAGGTGGCACATGTCAGTGGAAGATATGTGGACTTAGTCCCACTACAACCTTAGCCATATATTTTGAGGTTGTCAATCAGCATAATGCTCCAATTCCTCAAGGAGGGCGTGGTGCAATCCAGTTTGTGACTCAGTATCAGCATTCAAGTGGGCAGAGACGCATCCGAGTGACCACCATTGCTAGGAACTGGGCAGATGCTCAAACTCAAATCCAAAACATTGCTGCATCTTTTGACCAGGAGGCAGCTGCCATTCTTATGGCCCGGCTAGCAATATATAGAGCAGAAACAGAAGAAGGTCCAGATGTGCTTAGGTGGCTGGACAGACAGCTCATTCGACTGTGTCAGAAATTTGGAGAATATCATAAAGATGACCCAAGTTCCTTCAGATTTTCAGAAACTTTCTCCCTTTATCCACAGTTTATGTTTCATTTAAGAAGATCTTCTTTCCTGCAAGTTTTTAACAATAGTCCTGATGAGAGTTCATATTATCGTCACCATTTTATGCGTCAAGATCTGACCCAGTCTCTAATTATGATTCAGCCTATCCTGTATGCGTATTCTTTTAGTGGACCACCAGAGCCGGTTCTTCTTGATAGCAGTAGCATTCTTGCAGATCGTATTCTTCTCATGGACACATTCTTCCAGATTTTGATTTATCATGGTGAGACCATAGCACAGTGGCGGAAGTCAGGATACCAGGATATGCCTGAGTATGAAAATTTCCGCCACCTTCTGCAAGCCCCAGTGGATGATGCACAGGAAATTCTTCACTCCAGATTTCCAATGCCAAGATACATTGACACTGAACATGGAGGCAGCCAGGCCCGTTTCCTCCTTTCAAAAGTCAACCCTTCACAGACTCATAATAATATGTATGCCTGGGGGCAGGAGTCTGGAGCACCTATTCTTACAGATGATGTTAGTTTACAAGTGTTTATGGATCACTTGAAGAAACTTGCTGTGTCCAGTGCTGCTTGAAGTGCTAATAATGTTAAAGACACTTAAGAAGATGAAATAATATTCAAATTTCATTTTTTCCTTTTTCCATTTATCTGTGGAAACCAACAGATATTGCTCTATATTTTTTGTATTAGTATGGTTTGAGACAACATATGGAAAATGTTCACATTTGTAGATTAAGCTGGAATTATAATGAGAGCAATAAGAACAAATTTATTTTGCTTACCACAGTGTTATAGCTGGTTCTAGAAATTTGAAGTCTTTATAACTTAATTATGTTTAATAAAAAATAGAGTCTGCCTCGTACTACAGATGTAACTCATTTGTATATTGCAGACAGACCCAAAGTGGCACTGAATTTTCTTGCTCACCTTTTAAAAACTTGTTCCTTAATTTTAGCCAGAAAGCAAAAAAACAATAGTAATGATAAATGTGAACATTTTTGCTTATTCATTGAATATTTTTCTGTAATTTTCAGCACTTATGTATACACTTTTTCTGTACTTACTAGGTTAAGGCAGATTTATTTTTATGATTTGTTTAGGAATTATTTGATTTTATAATGGTAATTTTCATGATGATAATGTTTTTGGTTATTTGGAAAGATAGTTTAGAGATGAAAGGTTTTTTTGGGTAACAATCCCGCAGCTGACAAAAAATGTGAAATTTCCACAAAATATCCAACTTATGTGACTAAACGCAGTAGTTTTTTTAAAAGGGGAGATAGAAAATAAATGGTTTTGTTGGAGTGCATTTTAGTAAGCCTTTGCAGTAAAATGACGGTTGTAACTACTAAACCAAATTTAGTTTTCACAGCATGGTTTTGTTGTTTTCCCCTTGTTTTTCAGAGGTAAATTTTGCATTATATCCTTCAGTATTTTAACACTATTTTGGCAGTTTACACATTACTTTTTGTTTTTCCTTCCTTTTTGTGAAATGTATTAAGTTGTGGTTCTTATTGAAACAGTATTATATAATGTTTGCTTAATTATATCATGTGATGCTCAGTTCTATTTTGATTTATTCATTAGTATTCACTTTTACCTTTAAAGTTTACTTGTAGCAAATATGTTTACATTGATAAAGCCAGATATGTTTTGACAATGAAATTTACATATCAAGTACTGCAAATAAAAGGTGGTGCTATGATATATGCTTAGGAGGACAGTTTTAATGATTGTACTTGCATGAACACAATCATATGATGGTAAAGCAGAAACTTAAGAAAAAATTGTTTATGTGTTATATTCAATTAGCTTAAATAAGTTGCTTTGTTATATTTTATTTGAATTGAACTACGCTAGGCCTAAATGCCAATAAAATATACTTTTCACTGTT