Transcript asmbl_27434

Sequence
Transcript Sequence for observation asmbl_27434 of TGE0000420:
TTTCGGCTTTGTGAGAAACCTTACCATCAAACACGATGGCCAGCAACGTTACCAACAAGACAGATCCTCGCTCCATGAACTCCCGTGTATTCATTGGGAATCTCAACACTCTTGTGGTCAAGAAATCTGATGTGGAGGCAATCTTTTCGAAGTATGGCAAAATTGTGGGCTGCTCTGTTCATAAGGGCTTTGCCTTCGTTCAGTATGTTAATGAGAGAAATGCCCGGGCTGCTGTAGCAGGAGAGGATGGCAGAATGATTGCTGGCCAGGTTTTAGATATTAACCTGGCTGCAGAGCCAAAAGTGAACCGAGGAAAAGCAGGTGTGAAACGATCTGCAGCGGAGATGTACGGGTCAGTAACAGAACACCCTTCTCCGTCCCCTCTACTCAGCTCCTCTTTTGACTTGGACTATGACTTTCAACGGGACTATTATGATAGGATGTACAGTTACCCAGCACGTGTACCTCCTCCTCCTCCTATTGCTCGGGCTGTAGTGCCCTCGAAACGTCAGCGTGTATCAGGAAACACTTCACGAAGGGGCAAAAGTGGCTTCAATTCTAAGAGTGGACAGCGGGGATCTTCCAAGTCTGGAAAGTTGAAAGGAGATGACCTTCAGGCCATTAAGAAGGAGCTGACCCAGATAAAACAAAAAGTGGATTCTCTCCTGGAAAACCTGGAAAAAATTGAAAAGGAACAGAGCAAACAAGCAGTAGAGATGAAGAATGATAAGTCAGAAGAGGAGCAGAGCAGCAGCTCCGTGAAGAAAGATGAGACTAATGTGAAGATGGAGTCTGAGGGGGGTGCAGATGACTCTGCTGAGGAGGGGGACCTACTGGATGATGATGATAATGAAGATCGGGGGGATGACCAGCTGGAGTTGATCAAGGATGATGAAAAAGAGGCTGAGGAAGGAGAGGATGACAGAGACAGCGCCAATGGCGAGGATGACTCTTAAGCACATAGTGGGGTTTAGAAATCTTATCCCATTATTTCTTTACCTAGGCGCTTGTCTAAGATCAAATTTTTCACCAGATCCTCTCCCCTAGTATCTTCAGCACATGCTCACTGTTCTCCCCATCCTTGTCCTTCCCATGTTCATTAATTCATATTGCCCCGCGCCTAGTCCCATTTTCACTTCCTTTGACGCTCCTAGTAGTTTTGTTAAGTCTTACCCTGTAATTTTTGCTTTTAATTTTGATACCTCTTTATGACTTAACAATAAAAAGGATGTATGGTTTTTATCAACTGTCTCCAAAATAATCTCTTGTTATGCAGGGAGTACAGTTCTTTTCATTCATACATAAGTTCAGTAGTTGCTTCCCTAACTGCAAAGGCAATCTCATTTAGTTGAGTAGCTCTTGAAAGCAGCTTTGAGTTAGAAGTATGTGTGTTACACCCTCACATTAGTGTGCTGTGTGGGGCAGTTCAACACAAATGTAACAATGTATTTTTGTGAATGAGAGTTGGCATGTCAAATGCATCCTCTAGAAAAATAATTAGTGTTATAGTCTTAAGATTTGTTTTCTAAAGTTGATACTGTGGGTTATTTTTGTGAACAGCCTGATGTTTGGGACCTTTTTTCCTCAAAATAAACAAGTCCTTATTAAACCAGGAATTTGGAGAAAAAAAAAACCCTGGTTTTTTATTTTTGTATTTTATTATTGTTTACTTCAAACTTTGTTTTACAGCGTCCTCCACAAAACCTCTAGAATGCACTAGATATATTTTTCTTGGAGTCATAATCATGATGCATACCAACACAACACTACTCAAATTATATTTCATTGAGATGCATGTTGCATTGAGGAGTCAACTTGACATAGAGTGGAGACTTTTTCAAAATGGCTTTTACATCCTAATGAAAGTTTGGGAAGTATATCCTCTCTGCCTTTTCATCAGTGCTTTGTGGTCCAGCTGGCACCCTTTCTGAGGTTTGTGTTTTGTGCTAAATGGTTTTGTCCTTAAATAGGAGAGGCTCAAAAACATCAAGATTTCAGGAAAATGGCGACAGCTGCATAATGGAACCCCCCTGCTTCTATTTTGTTCTTTTAATTACTATTTATAGCCCCAGTTACCTTCTGAATTCTGAAGTGTATATACCTCCATGTTCCTGAAAACAAGAAAACTCTTACTTCCTGATATTCCATAGACTGCCTTCCCAGGTGATTGAGAACATAGAGAATGTTACACATTTATTTTACTCTAAATGATCTTTTACCCCTGTTAGCTAATCTTTGTGTTTTCCTCAACTTTATTAATTACAGTGATTGCATTTTTAGCATCCAGTTGTAAGATGAATATATTAAACAGCTACCAGTGTTGGTGATACCTCATCCTTGAAAGGCTTAGTTCATTTGTGTTTTATACTTCAGTTTTTCCAGCATAGCAGAAAATGCCGCTTATAATTTTTGTGCACACAAACCTTGGATTCCCCTGTAAAGTTGCTATTGTTTCATAGCATGCGGCACTGGCCTTTTTTCATCCTACTCATTACAGGCAAAACTCATGTCTTATTTATGAGGATTTTATAGATCATTTTCTGTAACAGGTGACAAAAGCAGAAAAGAATGAAGAGGCTGAAGTATGAACTACCCTTGGAGCCCATATACATGATATAGGCAATTTCTTTTGTATGTTAATTCAGTCAAAAATACTACCCACTTGATGTTTTCTAATCTGATGTGAGCTCATGTTACACAGACTTTTAGTAAGTAACCCGTGACTAGAAAATAAACTGGATGCTTAGGAGAGAGTGTCAGATGTATAAGATGCTAATAAAACCTGTTTAATATTATTGTTAGCTGTAAGTTTTTGGGAAATACTGAACAAATTAGTCCACAATCAAGTGTCTACTTTTCCCTTCACTGTAGGGCCTCTCCCTGCACAGAGCAGTCTGTTTAGCTGTGAACACCACAATCTGCAGATGTTCAAGTCCCTTACATAAAATGGCATAGTATTTATATGTAACCTATGCATATTCTCCTGTATATTTTAAATCATCTCTACATTAAAATACCTGAT