Transcript asmbl_26970

Sequence
Transcript Sequence for observation asmbl_26970 of TGE0000950:
GCCCAGTCTCCTCGCTGCAGTCGCTCCGGAGCTGCACGGGTGTTTTGCGTGTTGCTGCGTCATCGCCAGTGGCCGGTTTGAATGAGACTCGTCGCACCGAAGCCGCCGCCACCACCGCGCCTCCGCCTCGGCCGCCGCCGCAGCTGCTCCTGGTCCCCGTCCCTTTGCCGCCCTCGTCAGGCCCAGCTCTCCTGCGCCGCCGCCTCCCGCCGCGCCCCGCCATGCCGCTCTACTCCGTTACTGTAAAATGGGGAAAGGAGAAATTTGAAGGTGTAGAATTGAATACAGATGAACCTCCAATGGTATTCAAGGCTCAGCTGTTTGCGTTGACTGGAGTCCAGCCTGCCAGACAGAAAGTTATGGTGAAAGGAGGAACGCTAAAGGATGATGATTGGGGAAACATCAAAATAAAAAATGGAATGACTCTACTAATGATGGGGTCAGCAGATGCTCTTCCAGAAGAACCCTCAGCCAAAACTGTCTTCGTAGAAGACATGACAGAAGAACAGTTAGCATCTGCTATGGAGTTACCATGTGGATTGACAAACCTTGGTAACACTTGTTACATGAATGCCACAGTTCAGTGTATTCGTTCTGTGCCTGAACTCAAAGATGCCCTTAAAAGGTATGCAGGTGCCTTGAGAGCTTCAGGGGAAATGGCTTCAGCGCAGTATATTACTGCAGCCCTTAGAGATTTGTTTGATTCCATGGATAAAACTTCTTCCAGTATTCCACCTATTATTCTACTGCAGTTTTTGCACATGGCTTTCCCACAGTTTGCCGAGAAAGGTGAACAAGGACAGTATCTTCAACAGGATGCTAATGAATGTTGGATACAAATGATGCGAGTATTGCAACAGAAATTGGAAGCAATAGAGGATGATTCTGTTAAAGAGACAGACTCCTCATCTGCATCGGCAGCGACACCTTCTAAAAAGAAAAGTTTAATCGATCAGTTCTTCGGTGTTGAGTTTGAAACTACCATGAAATGTACAGAATCTGAAGAAGAAGAAGTCACCAAAGGAAAGGAAAATCAACTTCAGCTTAGCTGTTTTATCAATCAGGAAGTCAAGTATCTTTTTACAGGACTTAAATTGCGACTTCAGGAAGAAATCACCAAACAGTCTCCAACGTTGCAAAGAAATGCCTTGTATATCAAATCTTCCAAGATCAGCCGGCTGCCTGCTTACTTGACCATTCAGATGGTTCGATTTTTTTATAAAGAGAAGGAATCTGTGAATGCCAAAGTTCTTAAGGATGTTAAATTTCCTCTTATGTTGGATATGTATGAACTGTGTACACCAGAACTTCAAGAGAAAATGGTGTCTTTTCGATCCAAATTCAAGGATCTAGAAGATAAAAAAGTGAATCAGCAGCCAAATACAAGTGACAAAAAGAGTAGTCCCCAGAAAGAAGTTAAGTATGAACCCTTTTCTTTTGCTGATGATATTGGCTCCAATAATTGTGGATACTATGACTTACAAGCAGTACTAACACACCAGGGAAGGTCTAGTTCTTCAGGTCATTATGTATCATGGGTGAAAAGGAAACAAGATGAATGGATTAAGTTTGATGATGACAAAGTCAGCATCGTAACACCAGAAGATATCTTACGGCTTTCTGGTGGTGGAGACTGGCATATCGCTTACGTTCTACTCTATGGGCCTCGCAGAGTTGAAATAATGGAAGAGGAAAGTGAACAGTAATCTTCATTTTAGTATTTATGCTTAGATGTGAAAATAAATGTTATTTGTTGATCATTTCTATAATCCAGAGCTTTAGAGGAAGACACATAGGTGGGTTTATGTTTCACCTCATTTGGAACAAAAGAGGACAGAAGCAGACCACTCTGTGCACCAACCTAAAAAATTACAGAGAAGAGAAAATTATCTTTGGATTGTGCTGCCCTATATAAAGGTGGCAGAAAGACATTTTTAAAAAGCTTATTATTTCTTGCATTATTTTAAAAAGTTCAGAGTTGAAATGCCTTTCAACCATTTCCTTCTGTGGTCATTTTTCTTGCTGCCTTTTTCACCCAAGATTCAGCAGTCAGATGTTTACTGCACACCTATTACCTATTATTTGCTGTTCTTGCATGGTTCAAACCACCATTCTGTAGCCACCCATCCTTTGCCTTATCTAACAAACATTTTTCCAGGAAGGTGGAAAAGGAAGTGTTGCTCTCATTGTGTGACTCAGTGCTGCTGTCCATCCCATGGAAACATGGGCACAATCAAGTATTTGTCCAGCCTATTGCAGGCTTTTCCTGACTTTAAAATAAATTGTGATCAATAATAGTACCTTTGATTATACATTTATTATTGTGTCTCTCTCTGATGTACTGTGGATTGTACATTTAACTTTGGAATGGCTTTGTAATAATCAGTCTTAAGAAAATGTTGACAAGCTCTGGTTGCTTATTTTTAGAAAATGAGGACATTTAATAATAATAAAAAAAAAGGGATTAATAGCTTTTGACCTCAAGTCTTTTGTCTTCTGAGTGTTGGAGCTTGGCTGAAGACATGTTTAATACTGTACAATTTCTGAAGATGGTTATTAACACTGTGCTGTTAAGCATCCATTTAAAAATATTTGTTATCTTCTTTGCCTGCCTGTATTTTAAAAAGAAATACAAAGTTGTAAAAGTAATGGATTTCTTTGGATGCTGAATGCAGTGATGTTATCAGTCAGATTCTTTCCTTGGCTCAGTTGTGTTTGTATTTCCTTTCTTAATTCCCCAAATCTTGGCTGGGCACGGTGGCTCACGCCTGTAATCCCAGCACTTT