Transcript asmbl_23817

Sequence
Transcript Sequence for observation asmbl_23817 of TGE0000342:
GGCCATCTTGAGCCCCGCCTTTTACTTCGGCCCGCTTCTTCTGGTCACTCCGCCACCGTAGAATCGCCTACCATTTGGTGCAAGCAAAAAGCAATCAGCAATTGGACAGGAAAAGAATGGCATTGAAGCAGATTTCCAGCAACAAGTGCTTTGGGGGATTGCAGAAAGTTTTTGAACATGACAGTGTTGAACTAAACTGCAAAATGAAATTTGCTGTCTACTTACCACCAAAGGCAGAAACAGGAAAGTGCCCTGCACTGTATTGGCTCTCAGGTTTAACTTGCACAGAGCAAAATTTTATATCAAAATCTGGTTATCATCAGTCTGCTTCAGAACATGGTCTTGTTGTCATTGCTCCAGATACCAGCCCTCGTGGCTGCAATATTAAAGGTGAAGATGAGAGCTGGGACTTTGGCACTGGTGCTGGATTTTATGTTGATGCCACTGAAGATCCTTGGAAAACCAACTACAGAATGTACTCTTATGTCACAGAGGAGCTTCCCCAACTCATAAATGCCAATTTTCCAGTGGATCCCCAAAGGATGTCTATTTTTGGCCACTCCATGGGAGGTCATGGAGCTCTGATCTGTGCTTTGAAAAATCCTGGAAAATACAAATCTGTGTCAGCATTTGCTCCAATTTGCAACCCTGTACTCTGTCCCTGGGGCAAAAAAGCCTTTAGTGGATATTTGGGAACAGATCAAAGTAAATGGAAGGCTTATGATGCTACCCACCTTGTGAAATCCTATCCAGGATCTCAGCTGGACATACTAATTGATCAAGGGAAAGATGACCAGTTTCTTTTAGATGGACAGTTACTCCCTGATAACTTCATAGCTGCCTGTACAGAAAAGAAAATCCCCGTTGTTTTTCGATTGCAAGAGGGTTATGATCATAGCTACTACTTCATTGCAACCTTTATTACTGACCACATCAGACATCATGCTAAATACCTGAATGCATGAAAAAACTCCAAATAAGAGAATCTCTTCAGGATTATAAAAGTTGTAAAATGCAACTGTATTGCTGAGC