Transcript asmbl_22987

Sequence
Transcript Sequence for observation asmbl_22987 of TGE0000294:
CCACCCTCTCACCCTAGACAGATGGGAGCCTCCTGGGGTGTCCACGTGAGCGCGCGTGAGTCCGCCCCCCCAGTCACGTGACCGCTGACTCGGGGCGTTCTCCACTATCGCTTACCTACCTCCCTCTGCAGGAACCCGGCGATATGGCTGCCGCTGTGCCCCGCGCCGCATTTCTCTCCCCGCTGCTTCCCCTTCTCCTGGGCTTCCTGCTCCTCTCCGCTCCGCATGGCGGCAGCGGCCTGCACACCAAGGGCGCCCTTCCCCTGGATACGGTCACTTTCTACAAGGTCATTCCCAAAAGCAAGTTCGTCTTGGTGAAGTTCGACACCCAGTACCCCTACGGTGAGAAGCAGGATGAGTTCAAGCGTCTTGCTGAAAACTCGGCTTCCAGCGATGATCTCTTGGTGGCAGAGGTGGGGATCTCAGATTATGGTGACAAGCTGAACATGGAGCTGAGTGAGAAATACAAGCTGGACAAAGAGAGCTACCCAGTCTTCTACCTCTTCCGGGATGGGGACTTTGAGAACCCAGTCCCATACACTGGGGCAGTTAAGGTTGGAGCCATCCAGCGCTGGCTGAAGGGGCAAGGGGTCTACCTAGGTATGCCTGGTTGCCTGCCTGTATACGACGCCCTGGCCGGGGAGTTCATCAGGGCCTCTGGTGTGGAGGCCCGCCAGGCCCTCTTGAAGCAGGGGCAAGATAACCTCTCAAGTGTGAAGGAGACTCAGAAGAAGTGGGCCGAGCAATACCTGAAGATCATGGGGAAGATCTTAGACCAAGGGGAGGACTTCCCAGCATCAGAGATGACACGGATCGCCAGGCTGATTGAGAAGAACAAGATGAGTGACGGGAAGAAGGAGGAGCTCCAGAAGAGCTTAAACATCCTGACTGCCTTCCAGAAGAAGGGGGCCGAGAAAGAGGAGCTGTAAAAAGGCTGTCTGTGATTTTCCAGGGTTTGGTGGGGGTAGGGAGGGGAGAGTTAACCTGCTGGCTGTGAGTCCCTTGTGGAATATAAGGGGGTAGTGGGAAAAGTGGTACTAACCCACGATTCTGAGCCCTGAGTATGCCTGGACATTGATGCTAACATGACCATGCTTGGGATGTCTCTAGCTGGTCTGGGGATAGCTGGAGCACTTACTCAGGTGGCTGGTGAAATGACACCTCAGAAGGAATGAGTGCTATAGAGAGGAGAGAGGAGTGTACTGCCCAGGTCTTTGACAGATGTAATTCTCATTCAATTAAAGTTTCAGTGTTTTGGTTAAGTGGAC