Transcript asmbl_22983

Sequence
Transcript Sequence for observation asmbl_22983 of TGE0060326:
ATTTTCATAAACAATGAATGGCACGATGCCGTCAGCAGGAAAACATTCCCCACCGTCAATCCGTCCACTGGAGAGGTCATCTGTCAGGTAGCTGAAGGGGACAAGGAAGATGTGGACAAGGCAGTGAAGGCCGCCCGGGCCGCCTTCCAGCTGGGCTCACCTTGGCGCCGCATGGACGCATCACACAGGGGCCGGCTGCTGAACCGCCTGGCCGATCTGATCGAGCGGGACCGGACCTACCTGGCGGCCTTGGAGACCCTGGACAATGGCAAGCCCTATGTCATCTCCTACCTGGTGGATTTGGACATGGTCCTCAAATGTCTCCGGTATTATGCCGGCTGGGCTGATAAGTACCACGGGAAAACCATCCCCATTGACGGAGACTTCTTCAGCTACACACGCCATGAACCTGTGGGGGTGTGCGGGCAGATCATTCCGTGGAATTTCCCGCTCCTGATGCAAGCATGGAAGCTGGGCCCAGCCTTGGCAACTGGAAACGTGGTTGTGATGAAGGTAGCTGAGCAGACACCCCTCACCGCCCTCTATGTGGCCAACCTGATCAAGGAGGCTGGCTTTCCCCCTGGTGTGGTCAACATTGTGCCTGGATTTGGCCCCACGGCTGGGGCCGCCATTGCCTCCCATGAGGATGTGGACAAAGTGGCATTCACAGGCTCCACTGAGATTGGCCGCGTAATCCAGGTTGCTGCTGGGAGCAGCAACCTCAAGAGAGTGACCTTGGAGCTGGGGGGGAAGAGCCCCAACATCATCATGTCAGATGCCGATATGGATTGGGCCGTGGAACAGGCCCACTTCGCCCTGTTCTTCAACCAGGGCCAGTGCTGCTGTGCCGGCTCCCGGACCTTCGTGCAGGAGGACATCTATGATGAGTTTGTGGAGCGGAGCGTTGCCCGGGCCAAGTCTCGGGTGGTCGGGAACCCCTTTGATAGCAAGACCGAGCAGGGGCCGCAGGTGGATGAAACTCAGTTTAAGAAGATCCTCGGCTACATCAACACGGGGAAGCAAGAGGGGGCGAAGCTGCTGTGTGGTGGGGGCATTGCTGCTGACCGTGGTTACTTCATCCAGCCCACTGTGTTTGGAGATGTGCAGGATGGCATGACCATCGCCAAGGAGGAGATCTTCGGGCCAGTGATGCAGATCCTGAAGTTCAAGACCATAGAGGAGGTTGTTGGGAGAGCCAACAATTCCACGTACGGGCTGGCCGCAGCTGTCTTCACAAAGGATTTGGACAAGGCCAATTACCTGTCCCAGGCCCTCCAGGCGGGCACTGTGTGGGTCAACTGCTATGATGTGTTTGGAGCCCAGTCACCCTTTGGTGGCTACAAGATGTCGGGGAGTGGCCGGGAGTTGGGCGAGTACGGGCTGCAGGCATACACTGAAGTGAAAACTGTGACAGTCAAAGTGCCTCAGAAGAACTCATAAGAATCATGCAAGCTTCCTCCCTCAGCCATTGATGGAAAGTTCAGCAAGATCAGCAACAAAACCAAGAAAAATGATCCTTGCGTGCTGAATATCTGAAAAGAGAAATTTTTCCTACAAAATCTCTTGGGTCAAGAAAGTTCTAGAATTTGAATTGATAAACATGGTGGGTTGGCTGAGGGTAAGAGTATATGAGGAACCTTTTAAACGACAACAATACTGCTAGCTTTCAGGATGATTTTTAAAAAATAGATTCAAATGTGTTATCCTCTCTCTGAAACGCTTCCTATAACTCGAGTTTATAGGGGAAGAAAAAGCTATTGTTTACAATTATATCACCATTAAGGCAACTGCTACACCCTGCTTTGTATTCTGGGCTAAGATTCATTAAAAACTAGCTGCTCTT