Transcript asmbl_22526

Sequence
Transcript Sequence for observation asmbl_22526 of TGE0060315:
GCTCGGAAGAACCGAGAGGAGCTAGACAAGTACTGGTCTCAGCAGATTGAGGAGAGCACCACAGTGGTCACCACACAGTCTGCTGAGGTTGGAGCTGCTGAGACGACGCTCACAGAGCTGAGACGTACAGTCCAGTCCTTGGAGATCGACCTGGACTCCATGAGAAATCTGGTGAGTGCCTTCACATCACCTGCCCAGCTCCTCCTTCACTTGGCCTCAGACCCAACCCTGTCTCAACCCAAATCCTATCCCTCATATCATGAGTTCCTTTAGCTCAGAAAGAGTCAGTTTCCTCTTTGCATTTCCCTCCACTCCTATCCCTTATCCCAGTACTTGGCACATAGCAGGTGCCCAAAAAAGTTTCCAAAAGTGAAGGGATGAGCAGTCCTGGGACTCTGGGCTCACCCTGCCCCTCCTCTCTGTGCCCCTGCAGAAGGCCAGCTTGGAGAACAGCCTGAGGGAGGTGGAGGCCCGCTACGCCCTACAGATGGAGCAGCTCAACGGGATCCTGCTGCACCTTGAGTCAGAGCTGGCACAGACCCGGGCAGAGGGACAGCGCCAGGCCCAGGAGTATGAGGCCCTGCTGAACATCAAGGTCAAGCTGGAGGCTGAGATCGCCACCTACCGCCGCCTGCTGGAAGATGGCGAGGACTTTAATCTTGGTGATGCCTTGGACAGCAGCAACTCCATGCAAACCATCCAAAAGACCACCACCCGCCGGATAGTGGATGGCAAAGTGGTGTCTGAGACCAATGACACCAAAGTTCTGAGGCATTAAGCCAGCAGAAGCAGGGTACCCTTTGGGGAGCAGGAGGCCAATAAAAAGTTCAGAGTTCA