Transcript asmbl_30652

Sequence
Transcript Sequence for observation asmbl_30652 of TGE0004776:
GTCCAGGCTGCTACAGAGGAGTGGCGGGCCCTGGAGACAGGCTAGCGGTGTCGGCGTGAACTAATTCGTTCAAGCCTTGGGCTGCAGAACTGCCCAGAAGAGTGCCGAGAAGGTGGCGCGTAACTTCGGCAGATCCCAGAAGTGCAGCTAGGAAACTTGCCCAGCCAGCCAGGCCCATAGGGTGCTAGAGGGTCAGGAAGGACCCGCCTTTCCTAGACCGTGGCCCAACAGATCCACGTGAGGCTTCCTCGCCACCAAAAGCCCCAAACAAGCAGGGCTAATGAAAGAGGAAAGTTAAGGACGTCCCAAGCTCTGAGACGCGGCGCCCCGCTGCCGGCGCAAGAGCTGCTCTTCCAACAGCTGCGCTTGCAGTCGCCTTGTCCAGCCGAGCGGAGGTCGCTGCCGCTGAGTGATGTCCCGCCGCAGCCTGGACGGGCGCCTCCTCGGGCTGCCCGCGACGTCGGCCCCGCCGCTGCCCCCCAAGTTGCTGCTGTTGCTGCTGCTGTCGGCCGCCGCGGTGCCACCGAGCCTGGCAGAAGTCTTCTATGCAACTGCGTACTGGATGCCTGCTGAAAAGACAGTAAATGTCAAAAATTTACTGGACAAGAATGGGGATGCCTATGGCTTTTATAATAACTCTATGAACACCACAGGCTGGGGGATCCTTGAGATCAAAGCAGGGTATGGTTCTCAGACCCTGAGCAATGACATCATCATGTTTGTGGCTGGATATTTGGAAGGTTACCTCACTGCCCCACACATGTATGACCACTTCATAAATCTCTACCCACAGCTGATTAAGAAACCTTCCATCGTGGATAAAGTGCAGGAGTTTATGAAGAAGCAAGAAGAATGGGCACGTAATAACATCAAATATTATAAGGATGACCCATTTTGGAGACATACTGGCTATGTTATGGCACAAATGGATGGGCTGTATGTAGGAGCGATGAACAGGGCTACATTAATAGGGACAAAGCCTATGACACTGTTCCAGATTCAGTTCCTGAATGCTGTTGGAGATCTGTTGGATCTGATTCCCTCACTTTCTCCCCCAAAAAACTCCAGCCTGAAGGTTTTTAAGAGATGGGACATGGGACACTGCTCTGCTCTTATTAAGGTTCTTCCTGGGTTTGAGAACATCTATTTTGCTCACTCAAGCTGGTACACGTATGCAGCCATGCTCAGGATATATAAACACTGGGACTTCAACATCGTCGATAAAGATACCAGCTGTAGTCGCCTCTCTTTCAGCAGTTACCCAGGATTCTTAGAGTCTCTGGATGACTTTTACATTCTTAGCAGTGGTTTGATATTGCTGCAGACCACAAACAGCGTGTATAATAAAACCCTACTAAAGTTTGTGACACCCCAGTCTCTCCTGGCCTGGCAAAGGGTCCGCGTGGCCAATATGATGGCCAATGGTGGCAGGCAGTGGGCAGAGATCTTTTCAAAATACAATTCTGGCACCTATAACAATCAGTACATGGTCCTGGACCTGAAGAGGGTAAAGCCAAAATATAGCCTTGACACAGAGACTCTGTACATTGTGGAGCAAATTCCTTCATATATAGAATTTTCTGACCAAACCGATGTCCTACGGAAAGGATACTGGCCCTCTTACAACATTCCTTTCCATGAAAAAATCTACAACTGGAGTGGCTATCCAATGTTAGTTCAGAGGCTGGGTTTGGACTACTCATATGATCTGGCTCCACGAGCCAAAATCTTCCGGCGTGACCAAGGGAAAGTGACTGATATGGCATCCATGAAATATATCATGCGATACAACAATTATAAGAACGATCCTTACAGTAGGGGTGATCCGTGCAATACCATCTGCTGCCGTGAGGACCTTAACTCACTTAACCCAAGTCCTGGAGGTTGCTATGATACAAAGGTGGCAGATATTTACCTAGCATCACAGTACACAGCACATGCCATTAGTGGTCCCACAGTACAAGGTGCCCTCCCTGTTTTTCACTGGAACCAGTTCAACAAAACTCTCCATGAGGGCATGCCAGAAGCCTACAACTTTGATTTTGTGACCATGCAACCAATTTTGAAACCTGACAAAAAATGAAGGGGGAATATGAGGGAATAGAAGGCTGCAAATAAGATACCAAAGGCACTATTTTAACTGTTTTTCCATTCAAGATTAGTCTTAATAAAATGTCTTAAATTTA