Transcript asmbl_17992

Sequence
Transcript Sequence for observation asmbl_17992 of TGE0000096:
AATAATTCTTAAAGGAAGTAAAGTTAACTTTGAAAGAACTATCAGGATTTGGATTGACTGAAAGGAGTGGGGAAGCTTAGGGAGGAGGTGCTTGCCAGACACTGGGTCATGGCAGTGGTCGGTGAAGCTGCAGTTGCCTAGGGCAGGGATGGAGAGAGAGTCTGGGCATGAGGAGAGGGTCTCGGGATGTTTGGCTGGACTAGATTTTACAGAAAGCCTTATCCAGGCTTTTAAAATTACTCTTTCCAGACTTCATCTGAGACTCCTTCTTCAGCCAACATTCCTTAGCCCTGAATACATTTCCTATCCTCATCTTTCCCTTCTTTTTTTTCCTTTCTTTTACATGTTTAAATTTAAACCATTCTTCGTGACCCCTTTTCTTGGGAGATTCATGGCAAGAACGAGAAGAATGATGGTGCTTGTTAGGGGATGTCCTGTCTCTCTGAACTTTGGGGTCCTATGCATTAAATAATTTTCCTGACGAGCTCAAGTGCTCCCTCTGGTCTACAATCCCTGGCGGCTGGCCTTCATCCCTTGGGCAAGCATTGCATACAGCTCATGGCCCTCCCTCTACCATACCCTCCACCCCCGTTCGCCTAAGCTCCCTTCTCCGGGAATTTCATCATTTCCTAGAACAGCCAGAACATTTGTGGTCTATTTCTCTGTTAGTGTTTAACCAACCATCTGTTCTAAAAGAAGGGCTGAACTGATGGAAGGAATGCTGTTAGCCTGAGACTCAGGAAGACAACTTCTGCAGGGTCACTCCCTGGCTTCTGGAGGAAAGAGAAGGAGGGCAGTGCTCCAGTGGTACAGAAGTGAGACATAATGGAATCAGGCTTCACCTCCAAGGACACCTATCTAAGCCATTTTAACCCTCGGGATTACCTAGAAAAATATTACAAGTTTGGTTCTAGGCACTCTGCAGAAAGCCAGATTCTTAAGCACCTTCTGAAAAATCTTTTCAAGATATTCTGCCTAGACGGTGTGAAGGGAGACCTGCTGATTGACATCGGCTCTGGCCCCACTATCTATCAGCTCCTCTCTGCTTGTGAATCCTTTAAGGAGATCGTCGTCACTGACTACTCAGACCAGAACCTGCAGGAGCTGGAGAAGTGGCTGAAGAAAGAGCCAGAGGCCTTTGACTGGTCCCCAGTGGTGACCTATGTGTGTGATCTTGAAGGGAACAGAGTCAAGGGTCCAGAGAAGGAGGAGAAGTTGAGACAGGCGGTCAAGCAGGTGCTGAAGTGTGATGTGACTCAGAGCCAGCCACTGGGGGCCGTCCCCTTACCCCCGGCTGACTGCGTGCTCAGCACACTGTGTCTGGATGCCGCCTGCCCAGACCTCCCCACCTACTGCAGGGCGCTCAGGAACCTCGGCAGCCTACTGAAGCCAGGGGGCTTCCTGGTGATCATGGATGCGCTCAAGAGCAGCTACTACATGATTGGTGAGCAGAAGTTCTCCAGCCTCCCCCTGGGCCGGGAGGCAGTAGAGGCTGCTGTGAAAGAGGCTGGCTACACAATCGAATGGTTTGAGGTGATCTCGCAAAGTTATTCTTCCACCATGGCCAACAACGAAGGACTTTTCTCCCTGGTGGCGAGGAAGCTGAGCAGACCCCTGTGATGCCTGTGACCTCAATTAAAGCAATTCCTTTGACCTGTCCAGTTGACTTTAGTCCTTGTTTCTAACTGCCAAGTCATGTGCTGAGTAGAGGCTCAGTGGTTGGGGCCCAATGGTTCATCTAGGACGGGACTAGAGAGGTCAGTCTACAAGCAATCCATTGACCACTTACTTGGTGCTGCACACAAATGTTGGTGCTATGGGACCCAAAGATGAGCAATTAGTATTCCAGTCTTCATTGCCTGTGCTTACAAAAGAAGACCTCACTTCCCTAAACATCTAGTTATGGCGGCTCAAGCCCGTACCTGCCTACAGAGAAGTGTCTGCAGTTACTCACTATTAGTTTCCTAAGGGGGCACTGCTGGCTCCTTCTCTCCCAGGAATGGGCTTCTCCTATTCTTTAACTCTTGCCTTCTCCCTGGAGAGGCTACCAAACCCTGGCCTCTGCCGCTGTTCAGGCTGCCATGTGGGTATAGCTGTTTGCTAGACTCCACTCTGGCCTCAGGGGCCAGAGAACAGCTGTCCAGCATTTCTGTTCATCCCAGCAATCCAAAAAAAAATTTTTTTAAGCTACAAAGATCACTCCATTTTCAAATTCAGACTCTGCCACTTATTAGCTGTTTCTCATTAGGCAAGTTATATAACCTTGCAGTGCCTCACTTTCCTCATCTATAAAATGAGATTAAAATAGTCTTTTTATTAAGAGAATTAAAGTGAATTGTGGCCAGGCACTGTGGCTCATGCCTGTAATCCCAGCGCTTTGGGAGGCTGAGGCAGACAGATTGCTTGAGCTCAGAAGTTCGAGACTGGCCTGGGGAACATGCAAAAACCCTGTCTGTATTAAAAATACAAAAAAATTAGCTAGGTGTGGCGGCATATGCCTGTGGTCCCAGCTACTCAGGAGGCTGAAGTGGGAGGATGGCTTGAGCCCGGGAG