Transcript asmbl_11223

Sequence
Transcript Sequence for observation asmbl_11223 of TGE0000093:
AAGGAAATGCACAAAAATAATAAATTGGCATTACCAGCTGATTCAGTTAATATAAAAATTCTGAATGCTGGCGCCTGGTCAAGAAGTTCTGAGAAAGTCTTTGTCTCACTTCCTACTGAACTGGAGGACTTGATACCGGAAGTAGAAGAATTCTACAAAAAAAATCATAGTGGTAGAAAATTACATTGGCATCATCTCATGTCAAATGGAATTATAACATTTAAGAATGAAGTTGGTCAATATGATTTGGAGGTAACCACGTTTCAGCTCGCTGTATTGTTTGCATGGAACCAAAGACCCAGAGAGAAAATCAGCTTTGAAAATCTTAAGCTTGCAACTGAACTCCCTGATGCTGAACTTAGGAGGACTTTATGGTCTTTAGTAGCTTTCCCAAAACTCAAACGGCAAGTTTTGTTGTATGAACCTCAAGTCAACTCACCCAAAGACTTTACAGAAGGTACCCTCTTCTCAGTGAACCAGGAGTTCAGTTTAATAAAAAATGCAAAGGTTCAGAAAAGGGGTAAAATCAACTTGATTGGACGTTTGCAGCTCACTACAGAAAGGATGAGAGAAGAAGAGAATGAAGGAATAGTTCAACTACGAATACTAAGAACCCAGGAAGCTATCATACAAATAATGAAAATGAGAAAGAAAATTAGTAATGCTCAGCTGCAGACTGAATTAGTAGAAATTTTGAAAAACATGTTCTTGCCACAAAAGAAAATGATAAAAGAGCAAATAGAGTGGCTAATAGAGCACAAATACATCAGAAGAGATGAATCTGATATCAACACTTTCATATATATGGCATAATTTTGAATATCATGGACAATATTTAGAACCCAAATTTTGGAGTGCTTGGGCAGAAAGTTGTAAAGTTTGTGCTGGAGAAAGGTTTATTTGGACTTTGATTACATAAATATTAAAATCTCTGCCTTACCTTACAAAAACAACTATATTTTGCCAATCACA