Transcript asmbl_10504

Sequence
Transcript Sequence for observation asmbl_10504 of TGE0003332:
GCGGGCGGAACGGTGTCTCCTTCACTTCGCCCTCCAGCTGCTGGAGCTGCAGCCCGACCGCGAGCGTGCCAAGCGGCTTCAGCAGCTAGCGGAGCGGTGGCGGCGGCCCCCCTCAGGACACCACCAGATTCCCCTCTTCCCGCGGCCTCGCCATGGCGACCCACGGACAGACTTGCGCGCGTCCAATGTGTATTCCTCCATCATATGCTGACCTTGGCAAAGCTGCCAGAGATATTTTCAACAAAGGATTTGGTTTTGGGTTGGTGAAACTGGATGTGAAAACAAAGTCTTGCAGTGGCGTGGAATTTTCAACGTCCGGTTCATCTAATACAGACACTGGTAAAGTTACTGGGACCTTGGAGACCAAATACAAGTGGTGTGAGTATGGTCTGACTTTCACAGAAAAGTGGAACACTGATAACACTCTGGGAACAGAAATCGCAATTGAAGACCAGATTTGTCAAGGTTTGAAACTGACATTTGATACTACCTTCTCACCAAACACAGGAAAGAAAAGTGGTAAAATCAAGTCTTCTTACAAGAGGGAGTGTATAAACCTTGGTTGTGATGTTGACTTTGATTTTGCTGGACCTGCAATCCATGGTTCAGCTGTCTTTGGTTATGAGGGCTGGCTTGCTGGCTACCAGATGACCTTTGACAGTGCCAAATCAAAGCTGACAAGGAATAACTTTGCAGTGGGCTACAGGACTGGGGACTTCCAGCTACACACTAATGTCAATGATGGGACAGAATTTGGAGGATCAATTTATCAGAAAGTTTGTGAAGATCTTGACACTTCAGTAAACCTTGCTTGGACATCAGGTACCAACTGCACTCGTTTTGGCATTGCAGCTAAATATCAGTTGGATCCCACTGCTTCCATTTCTGCAAAAGTCAACAACTCTAGCTTAATTGGAGTAGGCTATACTCAGACTCTGAGGCCTGGTGTGAAGCTTACACTCTCTGCTCTGGTAGATGGGAAGAGCATTAATGCTGGAGGCCACAAGGTTGGGCTCGCCCTGGAGTTGGAGGCTTAATCCAGCTGAAAGAAACCTTTGGGAATGGATATCAGAAGATTTGGCCTTAATATATTTCCATTGTGACCAGCAGCAGGCTTTTTTCCCCCAAGAAGATGATCAAAACAAAGGATGATCTCAACAAGAGCTGTATTTTAAGTATTTAGACAGTTCTTTGTTAGCTGGTTTCTAGTTGGTTATCTAGTTACCAATGCTGCAGTCCTGCAGTCACCTATACATTATTTAAATGTATTTAACTGTTAAATGCGCTACCCACCAATAATGAAATAGACCTTTATGAAAACTGTGCAATTGTGTGCATGTTTGTTTTTATGTTCCTTTAGAAAACATTGACTGTTACCATTGAATGAGATGGATCAGTGGATATTAAGATGAGGTTACAAATTTTGTTAAGTTCAGCCATTATTACTTTTGGTATCCCAGAACATGACAAATTATGAATAAAACAAGTATACATAA