Transcript asmbl_10398

Sequence
Transcript Sequence for observation asmbl_10398 of TGE0060271:
TCTGGAAAGTGTGTAGTCATGTGTTTCTCCTTAAATTACACAGGTTATGGAGGTTTTGATGACTATGGTGGCTATAATAATTACGGCTATGGGAATGATGGCTTTGATGACAGAATGAGAGATGGAAGAGGTATGGGAGGACATGGCTATGGTGGAGCTGGTGATGCAAGTTCAGGTTTTCATGGTGGTCATTTCGTACATATGAGAGGGTTGCCTTTTCGTGCAACTGAAAATGACATTGCTAATTTCTTCTCACCACTAAATCCAATACGAGTTCATATTGATATTGGAGCTGATGGCAGAGCCACAGGAGAAGCAGATGTAGAGTTTGTGACACATGAAGATGCAGTAGCTGCCATGTCTAAAGATAAAAATAACATGCAACATCGATATATTGAACTCTTCTTGAATTCTACTCCTGGAGGCGGCTCTGGCATGGGAGGTTCTGGAATGGGAGGCTACGGAAGAGATGGAATGGATAATCAGGGAGGCTATGGATCAGTTGGAAGAATGGGAATGGGGAACAATTACAGTGGAGGATATGGTACTCCTGATGGTTTGGGTGGTTATGGCCGTGGTGGTGGAGGCAGTGGAGGTTACTATGGGCAAGGCGGCATGA