Transcript asmbl_30377

Sequence
Transcript Sequence for observation asmbl_30377 of TGE0008954:
GAGGATCTGACACACTTCTCAGGAGAATGCTGTTTGGCTCTTTTGAAGAATTAAAGAACTTTATGGATTAGTTTGCTAATAAGTACGTGCAAGATTTGAAGAGCTGAAGAAAAAAATCAGTATTAAACCCGTTTTTTTTTTAATATCCAGGTTGGAATTTGCCCTTGACAAAAACAAAATGATGAGTGATGCAAGTGACATGTTGGCTGCAGCATTGGAGCAAATGGATGGTATTATCGCAGGTTCTAAGGCCCTGGAATATTCCAATGGGATTTTTGATTGCCAGTCTCCCACCTCCCCATTCATGGGGAGCTTGCGAGCCCTGCACCTTGTGGAAGACCTGCGTGGATTGTTAGAGATGATGGAAACCGATGAGAAGGAAGGCTTGAGATGCCAGATCCCAGATTCAACAGCAGAAACGCTCATCGAATGGCTTCAGAGTCAGATGACAAATGGACACCTAACCGGGAATGGAGATGTGTATCAAGAAAGGCTAGCACGTTTAGAAAATGATAAAGAATCCCTCGTTCTTCAGGTAAGTGTGTTAACAGACCAGGTAGAGGCTCAAGGAGAGAAGATTCGAGATTTGGAGTTCTGTCTTGAAGAGCACAGAGAGAAGTTGAACGCCACAGAGGAGATGCTGCAGCAGGAGCTTCTGAGTAGGACATCCTTAGAAACTCAGAAGTTGGATCTGATGGCTGAAATATCTAACCTGAAGTTAAAACTGACTGCCGTAGAGAAGGACAGATTGGATTATGAAGATAGGTTCAGAGACACAGAGGGGCTAATGCAAGAGGTCAATAATTTGAGGTTAAGAGTCAGTGAAATGGACAATGAAAGACTTCAGTATGAAAAAAAGCTTAAATCAACCAAAGATGAACTGGCATCTTTAAAAGAACAATTAGAAGAGAAGGAATCTGAAGTAAAAAGGCTACAAGAAAAATTGTTTTGCAAGATGAAAGGAGAAGGGATTGAAGTTTTTGATCGAGATATTGAAGTACAAAAAATGAAAAAGGCTGTGGAGTCTTTGATGGCAGCAAATGAAGAAAAGGATCGGAAAATAGAAGACCTTCGACAGTGCCTGAACAGGTACAAGAAAATGCAAGATACAGTGGTACTGCCCCAAGGTAAAAAAGGCCAAGATGGTGACTATGAAGATCTGCTCACTTCTGGTTCTATCTCCACTCTGCTGGACACGCAGGGTTTTAGCGATCTGGAGAAAAGTCTGTCGTCTACACCAGTAACGGGATCTCCCAGTCGTGACCCATTTAACACAAGTATTCCAGAAGAGGTATTTACAGACTCTCAGTATTTTTTTC