Transcript asmbl_82180

Sequence
Transcript Sequence for observation asmbl_82180 of TGE0060247:
GGAGGGGACACGGGCTCATTGCGGTGTGCGCCCTGCACTCTGTCCCTCACTCGCCGCCGACGACCTGTCTCGCCGAGCGCACGCCTTGCCGCCGCCCCGCAGAAATGCTTCGGTTACCCACAGTCTTTCGCCAGATGAGACCGGTGTCCAGGGTACTGGCTCCTCATCTCACTCGGGCTTATGCCAAAGATGTAAAATTTGGTGCAGATGCCCGAGCCTTAATGCTTCAAGGTGTAGACCTTTTAGCCGATGCTGTGGCCGTTACAATGGGGCCAAAGGGAAGAACAGTGATTATTGAGCAGAGTTGGGGAAGTCCCAAAGTAACAAAAGATGGTGTGACTGTTGCAAAGTCAATTGACTTAAAAGATAAATACAAAAACATTGGAGCTAAACTTGTTCAAGATGTTGCCAATAACACAAATGAAGAAGCTGGGGATGGCACTACCACTGCTACTGTACTGGCACGCTCTATAGCCAAGGAAGGCTTCGAGAAGATTAGCAAAGGTGCTAATCCAGTGGAAATCAGGAGAGGTGTGATGTTAGCTGTTGATGCTGTAATTGCTGAACTTAAAAAGCAGTCTAAACCTGTGACCACCCCTGAAGAAATTGCACAGGTTGCTACGATTTCTGCAAACGGAGACAAAGAAATTGGCAATATCATCTCTGATGCAATGAAAAAAGTTGGAAGAAAGGGTGTCATCACAGTAAAGGATGGAAAAACACTGAATGATGAATTAGAAATTATTGAAGGCATGAAGTTTGATCGAGGCTATATTTCTCCATACTTTATTAATACATCAAAAGGTCAGAAATGTGAATTCCAGGATGCCTATGTTCTGTTGAGTGAAAAGAAAATTTCTAGTATCCAGTCCATTGTACCTGCTCTTGAAATTGCCAATGCTCACCGTAAGCCTTTGGTCATAATCGCTGAAGATGTTGATGGAGAAGCTCTAAGTACACTCGTCTTGAATAGGCTAAAGGTTGGTCTTCAGGTTGTGGCAGTCAAGGCTCCAGGGTTTGGTGACAATAGAAAGAACCAGCTTAAAGATATGGCTATTGCTACTGGTGGTGCAGTAAGTAAAATAAATGTGATAATGGTTTGCTGAATGTTTATACTTGTCTGGAATTTATAGATAGTTTAACATTTCACAATTAGATACTACAACTATCTGTTTCTTTTGGCTCTTTGGAAGGTAGGGG