Transcript asmbl_80998

Sequence
Transcript Sequence for observation asmbl_80998 of TGE0001355:
CCGGGGTAGGCTGACACGGGAGGGTCCTCAGCTAAAGCCAAAAGCAGATCAAAGTGGTGGGACTCGCGTCGCGGCCGCGGAGACGTGAAGCTCTCGAGGCTCCTCCCGCTGCGGGTCGGCGCTCGCCCTCGCTCTCCTCGCCCTCCGCCCCGGCCCCGGCCCCGCGCCCGCCATGGAGAAGACTGAGCTGATCCAGAAGGCCAAGCTGGCCGAGCAGGCCGAGCGCTACGACGACATGGCCACCTGCATGAAGGCAGTGACCGAGCAGGGCGCCGAGCTGTCCAACGAGGAGCGCAACCTGCTCTCCGTGGCCTACAAGAACGTGGTCGGGGGCCGCAGGTCCGCCTGGAGGGTCATCTCTAGCATCGAGCAGAAGACCGACACCTCCGACAAGAAGTTGCAGCTGATTAAGGACTATCGGGAGAAAGTGGAGTCCGAGCTGAGATCCATCTGCACCACGGTGCTGGAATTGTTGGATAAATATTTAATAGCCAATGCAACTAATCCAGAGAGTAAGGTCTTCTATCTGAAAATGAAGGGTGATTACTTCCGGTACCTTGCTGAAGTTGCGTGTGGTGATGATCGAAAACAAACGATAGATAATTCCCAAGGAGCTTACCAAGAGGCATTTGATATAAGCAAGAAAGAGATGCAACCCACACACCCAATCCGCCTGGGGCTTGCTCTTAACTTTTCTGTATTTTACTATGAGATTCTTAATAACCCAGAGCTTGCCTGCACGCTGGCTAAAACGGCTTTTGATGAGGCCATTGCTGAACTTGATACACTGAATGAAGACTCATACAAAGACAGCACCCTCATCATGCAGTTGCTTAGAGACAACCTAACACTTTGGACATCAGACAGTGCAGGAGAAGAATGTGATGCGGCAGAAGGGGCTGAAAACTAAATCCATACAGGGTGTCATCCTTCTTTCCTTCAAGAAACCTTTTTACACATCTCCATTCCTTATTCCACTTGGATTTCCTATAGCAAAGAAACCCATTCATGTGTATGGAATCAACTGTTTATAGTCTTTTCACACTGCAGCTTTGGGAAAACTTCATTCCTTGATTTGTGTTTGTCTTGGCCTTCCTGGTGTGCAGTACTGCTGTAGAAAAGTATTAATAGCTTCATTTCATATAAACATAAGTAACTCCCAAACACTTATGTAGAGGACTAAAAATGTATCTGGTATTTAAGTAATCTGAACCAGTTCTGCAAGTGACTGTGTTTTGTATTACTGTGAAAATAAGAAAATGTAGTTAATTACAATTTAAAGAGTATTCCACATAACTTCTTAATTTCTACATTCCCTCCCTTACTCTTCGGGGGTTTCCTTTCAGTAAGCAACTTTTCCATGCTCTTAATGTATTCCTTTTTAGTAGGAATCCGGAAGTATTAGATTGAATGGAAAAGCACTTGCCATCTCTGTCTAGGGGTCACAAATTGAAATGGCTCCTGTATCACATACGGAGGTCTTGTGTATCTGTGGCAACAGGGAGTTTCCTTATTCACTCTTTATTTGCTGCTGTTTAAGTTGCCAACCTCCCCTCCCAATAAAAATTCACTTACACCTCCTGCCTTTGTAGTTCTGGTATTCACTTTACTATGTGATAGAAGTAGCATGTTGCTGCCAGAATACAAGCATTGCTTTTGGCAAATTAAAGTGCATGTCATTTCTTAATACACTAGAAAGGGGAAATAAATTAAAGTACACAAGTCCAAGTCTAAAACTTTAGTACTTTTCCATGCAGATTTGTGCACATGTGAGAGGGTGTCCAGTTTGTCTAGTGATTGTTATTTAGAGAGTTGGACCACTATTGTGTGTTGCTAATCATTGACTGTAGTCCCAAAAAAGCCTTGTGAAAATGTTATGCCCTATGTAACAGCAGAGTAACATAAAATAAAAGTACATTTTATAAACCATTTACTATGGCTTTGTAACAATTGCATACCCATATTTTAAGGGACAGGTGAATTTACTACTTTCTAAAGTTTATTGATACTTCCCTTTTATGTAAAATGTAGTAGTGATACCTATATTTCCACATTGTGCATTGTGACACACTTGTCTAGGGATGCCTGGAAGTGTATAAAATTGGACTGCATTTCTTAGAGTGTTTTACTATAGATCAGTCTCATGGGCCATCTCTTCCTCAGATGTAAATGATATCTGGTTAAGTGTTATATGGAATAAAGTGGACATTTTAAAACTAGCAAAGTTAA