Transcript asmbl_71310

Sequence
Transcript Sequence for observation asmbl_71310 of TGE0001130:
GGCGGCTGGCCCGGCCGGCCTGGGCTTGGGCCTCCTCCAAGACTCGCCTGGCAGGAGGGCGGAGGCACCCCGGGAGGCTATAAGGCCCTCTCCTCCACCCTGCCAGGCTCACTCTGCCCCACAGCCACAGCCCCTGACTGCCGCAGCCCCCACAGAGCCCGCCGCGCACCCCACGTCCCCCACGCCAGCGCCCAGCCATGGAGGCCATCAAGAAGAAAATGCAGATGCTGAAGTTGGACAAGGAGAATGCCATCGACCGCGCGGAGCAGGCGGAGGCGGATAAGAAAGCCGCTGAGGACAAGTGCAAGCAGGTGGAGGAGGAGCTGACGCACCTCCAGAAGAAACTAAAAGGGACAGAGGACGAGCTGGATAAATATTCCGAGGACCTGAAGGACGCGCAGGAGAAGCTGGAGCTCACGGAGAAGAAGGCCTCCGACGCTGAAGGTGATGTGGCCGCCCTCAACCGACGCATCCAGCTCGTTGAGGAGGAGTTGGACAGGGCTCAGGAACGACTGGCCACGGCCCTGCAGAAGCTGGAGGAGGCAGAAAAAGCTGCAGATGAGAGTGAGAGAGGAATGAAGGTGATAGAAAACCGGGCCATGAAGGATGAGGAGAAGATGGAGATTCAGGAGATGCAGCTCAAAGAGGCCAAGCACATTGCGGAAGAGGCTGACCGCAAATACGAGGAGGTAGCTCGTAAGCTGGTCATCCTGGAGGGTGAGCTGGAGAGGGCAGAGGAGCGTGCGGAGGTGTCTGAACTAAAATGTGGTGACCTGGAAGAAGAACTCAAGAATGTTACTAACAATCTGAAATCTCTGGAGGCTGCATCTGAAAAGTATTCTGAAAAGGAGGACAAATATGAAGAAGAAATTAAACTTCTGTCTGACAAACTGAAAGAGGCTGAGACCCGTGCTGAATTTGCAGAGAGAACGGTTGCAAAACTGGAAAAGACAATTGATGACCTGGAAGAGAAACTTGCCCAGGCCAAAGAAGAGAACGTGGGCTTACATCAGACACTGGATCAGACACTAAACGAACTTAACTGTATATAAGCAAAACAGAAGAGTCTTGTTCCAACAGAAACTCTGGAGCTCCGTGGGTCTTTCTCTTCTCTTGTAAGAAGTTCCTTTTGTTATTGCCATCTTCGCTTTGCTGGAAATGTCAAGCAAATTATGAATACATGACCAAATATTTTGTATCGGAGAAGCTTTGAGCACCAGTTAAATCTCATTCCTTCCCTTTTTTTTTCAAATGGCACCAGCTTTTTCAGCTCTCTTATTTTTTCCTTAAGTAGCATTTATTCCTAAGGTAGGCAGGGTATTTCCTAGTAAGCATACTTTCTTAAGACGGAGGCCATTTGGTTCCTGGGAGAATAGGCAGCCCCACACTTTGAAGAATACAGACCCCAGTATCTAGTCGTGGATATAATTAAAACGCTGAAGACCATAACCTTTTGGGTCAACTGTTGGTCAAACTATAGGAGAGACCAGGGACCATCACATGGGTAGGGATTTTCCATCCAGAGCCAATAAAAGGACTGGTGGGGGCCGGGGGTGGCTATTGTGGGAAGTCATAACCCACAGATAGATCAACCTAAGAATCCTGGCCCTTCTCCACTCTCCACCATGCAGGACAAACATCTTCTCAAGCAGTCAACGTAGAATGCTTGGGAAATAGTCATAATTACCCACATATAGTAATTAATAGATGGTAATTAATTGATCCTTGATGTGATGTTCTTTTGCATATTTCCTTCATTCTAAAGTTGTTCCCTGGCCGGGAGCGTTGGCTTTCGCCTGTAATCCCAACACTTTGGG