Transcript asmbl_70780

Sequence
Transcript Sequence for observation asmbl_70780 of TGE0001028:
GCTCCCTCCCCCGCGCCGTGCACGTCTTGGTTCGGGCCGGGCATAAAAGGCTTCGCGGCCCAGGGCTCACTTGGCGCTGAGAACGCGGGTCCACGCGTGTGATCGTCCGTGCGTCTAGCCTTTGCCCACGCAGCTTTCAGTCATGGCCTCCGGTAACGCGCGCATCGGAAAGCCAGCCCCTGACTTCAAGGCCACAGCGGTGGTTGATGGCGCCTTCAAAGAGGTGAAGCTGTCGGACTACAAAGGGAAGTACGTGGTCCTCTTTTTCTACCCTCTGGACTTCACTTTTGTGTGCCCCACCGAGATCATCGCGTTCAGCAACCGTGCAGAGGACTTCCGCAAGCTGGGCTGTGAAGTGCTGGGCGTCTCGGTGGACTCTCAGTTCACCCACCTGGCTTGGATCAACACCCCCCGGAAAGAGGGAGGCTTGGGCCCCCTGAACATCCCCCTGCTTGCTGACGTGACCAGACGCTTGTCTGAGGATTACGGCGTGCTGAAAACAGATGAGGGCATTGCCTACAGGGGCCTCTTTATCATCGATGGCAAGGGTGTCCTTCGCCAGATCACTGTTAATGATTTGCCTGTGGGACGCTCCGTGGATGAGGCTCTGCGGCTGGTCCAGGCCTTCCAGTACACAGACGAGCATGGGGAAGTTTGTCCCGCTGGCTGGAAGCCTGGCAGTGACACGATTAAGCCCAACGTGGATGACAGCAAGGAATATTTCTCCAAACACAATTAGGCTGGCTAACGGATAGTGAGCTTGTGCCCCTGCCTAGGTGCCTGTGCTGGGTGTCCACCTGTGCCCCCACCTGGGTGCCCTATGCTGACCCAGGAAAGGCCAGACCTGCCCCTCCAAACTCCACAGTATGGGACCCTGGAGGGCTAGGCCAAGGCCTTCTCATGCCTCCACCTAGAAGCTGAATAGTGACGCCCTCCCCCAAGCCCACCCAGCCGCACACAGGCCTAGAGGTAACCAATAAAGTATTAGGGAAAGGTG