Transcript asmbl_70463

Sequence
Transcript Sequence for observation asmbl_70463 of TGE0001003:
GAAGGAGGAGCTGCGCGAGCTCAACGACCGCCTGGCGCACTACATCGACCGCGTCCGCGCGCTGGAGCTGGAGAACGACCGGCTCCTGCTCAAGATCTCAGAGAAGGAGGAGGTGACCACGCGCGAGGTGAGTGGCATCAAGGCGCTGTACGAGTCGGAGCTGGCCGATGCCCGGAGAGTCCTGGATGAGACGGCTCGAGAGCGTGCCCGGCTGCAGATAGAGATTGGGAAGCTGAGGGCAGAGTTGGACGAGGTCAACAAGAGCGCCAAGAAGAGGGAGGGCGAGCTTACGGTGGCCCAGGGCCGTGTGAAGGACCTGGAGTCCCTGTTCCACCGGAGCGAGGTGGAGCTGGCAGCTGCCCTCAGCGACAAGCGCGGCCTGGAGAGTGACGTGGCTGAGCTGCGGGCCCAGCTGGCCAAGGCCGAGGACGGTCATGCAGTGGCCAAAAAGCAGCTGGAGAAGGAGACGCTGATGCGTGTGGACCTGGAGAACCGCTGCCAGAGCCTGCAGGAGGAGCTGGACTTCCGGAAGAGTGTGTTCGAGGAGGAGGTGCGGGAGACGCGGCGGCGGCACGAGCGGCGCCTGGTGGAGGTGGACAGCAGCCGGCAGCAGGAGTACGACTTCAAGATGGCACAGGCGCTGGAGGAGCTGCGGAGCCAGCACGACGAGCAAGTGCGGCTCTACAAGCTGGAGCTGGAGCAGACCTACCAGGCCAAGCTGGACAGCGCCAAGCTGAGCTCTGACCAGAACGACAAGGCGGCCAGTGCGGCTCGCGAGGAGCTGAAGGAGGCCCGCATGCGCCTGGAGTCCCTCAGCTACCAGCTCTCCGGCCTCCAGAAGCAGGCCAGTGCCGCTGAAGATCGCATTCGGGAGCTGGAGGAGGCCATGGCCGGGGAGCGGGACAAGTTCCGGAAGATGCTGGACGCCAAGGAGCAGGAGATGACGGAGATGCGGGACGTGATGCAGCAGCAGCTGGCCGAGTACCAGGAGCTGCTGGACGTGAAGCTGGCCCTGGACATGGAGATCAACGCCTACCGGAAGCTCCTGGAGGGCGAGGAGGAGAGGCTGAAGCTGTCCCCCAGCCCATCCTCGCGCGTCACCGTCTCACGAGCCACCTCGAGCAGCAGCGGCAGCTTGTCCGCCACCGGGCGCCTGGGCCGCAGTAAGCGGAAGCGGCTGGAGGTGGAGGAGCCCTTGGGCAGCGGCCCAAGCGTCCTGGGCACGGGCACGGGTGGCAGCGGTGGCTTCCACCTGGCCCAGCAGGCCTCGGCCTCGGGTAGCGTCAGCATCGAGGAGATCGACCTGGAGGGCAAGTTTGTGCAGCTCAAGAACAACTCGGACAAGGATCAGTCTCTGGGGAACTGGAGAATCAAGAGGCAGGTCTTGGAGGGGGAGGAGATCGCCTACAAGTTCACGCCCAAGTACATCCTGCGCGCCGGCCAGATGGTCACGGTGTGGGCAGCTGGTGCGGGGGTGGCCCACAGCCCCCCCTCGACGCTGGTGTGGAAGGGCCAGAGCAGCTGGGGCACGGGCGAGAGCTTCCGCACCGTCCTGGTTAACGCGGATGGCGAGGAAGTGGCCATGAGGACTGTGAAGAAGTCCTCGGTGATGCGTGAGAATGAGAATGGGGAGGAAGAGGAGGAGGAAGCCGAGTTTGGCGAGGAGGATCTTTTCCACCAACAGGGGGACCCGAGGACCACCTCAAGAGGCTGCTACGTGATGTGAACCCACACTCCTCATCCACACACCTTTCTTTACCCAGAGCCACTGAAAACTATTTTTATATCATTGGCTTTCTTTAGTTCTTGATACATTTCTAGAGAATTTCTAAGCGAACTGCCAGAACGTGTGGGTGGGTCTCCCCCAGCCCTCCCTCCTGGCGGGTCTCCTCCAGCCTCACTTCGCTGCCACTTCGCCGCTGCCCCGGAGACTTTTCAATCCCACCCCACTCCTCATCTCACCATTTGGTCAAATTGGAAGCCCAGGGCCAGGACCCGGAGGTTTAGAAGATGCTTGGGCTTGGAGGGAGGAGGGCCGGCGAGGCTAGCGAGGGGACAGGAGACGGCCCTGCTGCGGACGGAGCGCGGAAACTGCGTAGGAATTCAGTGGTGGTGGGTTTTTTTAAGGCTTTCTACAAAACCAAATTCAGAATCCAGGCGTCGACCTGGTGGGGCCCGGGGCCAAGCCTGCATTCTGGCTGCCCAGCTTCGGACAGCGGGAACTCCTCAGGCAGCCACGCAGCGGGTGTGGGCCAGCATGGGGATGGCGTGGCCCCCAGGGCGGGTTTTCACTCCGCTGCCTGGGCTTCCAGATTCCCGTTCTGGCAGCGCACCGGCCGGGTTTCTCGGACCGTTGACTTTATTTGGGGGAGTTTTCCCGCAGTTCAGTTCCTGACTGTGCAAGGCCAACAGGGCAGGGGAGGGGAAGACCTGGGGAAGGAAGAATGAGGACAGTCCCGTCGTAAGACCTGTCACAACAATAAGCAGGGAGGGGAGATGTGGAGGGGACACATCTGGTTGCCTTGGAGGCAGAAGCTGTGAGTTTCAGAACAGCTGTCTGCAGGGAACGCCACCATGTTGACCCTCTGGAGGAGAGCGCTGTGGAGCCCCTCCCGTGTTCCAGCTCCGTCTGCCCTGTGCCTATATATACACATGCGTCTATCCATACTGTGCTTTTATCTGTGATTTTCTCGCTGAAACCATGTTTCTCAGACAGGCCAAGGCCACCTGACTCCTATCACGACGCACCCAAGCCCCTCAGTCCAGCTTCCCAATGCCTGGCACCCCCCTTCGGCAATAGCTCACCGTTTACACCCTCCCTCATAGATACACAGAAGTTATTTTTTTAATGGATATTTATTTTTTTACATTGGTCAGTACACAGGTCAGGAGCTCACGCCAGGGCCTTGAGGACAGGCTGACCCTCCTCCCCGGGGTGGCGTGGGGCTGGGGCACCCTCCGACGGCAGAGCCTCCTTCAGAAAGTGCAGCTCAAGTCTTAAAGACACCAAAACTGAGCCATGGGCACGCGCCGTCTCCGGGCCATGGCGTTCACTGCAGGGCGGGGGCGGCACCGCTCCCCTGTGACTGCATCCCGCCTCCCTGGGGACCTGCCTGTGGCAGGAAGGAATGGGGGGCCCCAGCCCCAGGCCGGGAAGGAGCCAGCGGCCGACAAAGCAGAAACACCCGCTGCTCCACGTAGCCCCTGCTCGCTGTCCTTGCTCTCAGAAGTCCCGGTCCCATGTAGATAGAGGGGGGCGCATCTTACCAAAGCATTTCCTCCTGGAGGCTACGCCGCTGTGCTCCCAGTCAGGCGGCTGGTAGGGAGCTTTGCCTGCCCCGGGGATACCCTCTGCCAGCCGCTGGAAGTGGGAATGCTGGCGACAGACTGTGTCCTCTTTCCCACCTTCATAGCAGGAATCACCCGGACCCGACTGGCTGGGCTTCGTGCTAGCGAGGGTTCTGGGGGTGGGTCTTGGTGATCTTGTCCTATGGGGAGTCTGCAGTGGTCTCAGCCACATCCTATGTATTTTGGCTCTGGAGGAGCAAAGCTGTATCCTGGAGTTGGTCTGTGATTTGCCGACAGCCTTGCAGGCTGGGCTCAGGGACAAAGTCCCCCCCAAAACCCGCAGGTCCTCATGTCCAGACGCTGCCCAGTCCTGTCCTGAAAACAGCACGCCCCAGGCCCACAGAACCCCCCACCCTACATTTGCCTTGGGTGGAGCTGGGGGTGGTCCTAGGACTGCGGGTGCCCTTAGCTGAAGGGGGTGGGGAGAAGCGTGGACTGGGCAGCCTGTGGGTAATTGGAGGTTCATTGAGAATTGAGTCTTTGGAAACACTAAGAAAATCAAATTTTTAAAAGTTATTTATGGCCTGGGAAACAATTTGCATTTGTCCCCAAATACGCTTAGCTGTGTGCCGCTTAGAACGATGCGAAACCATCCCTCTGTGTAAGCCCGTGCCGTGTGACTCGAAGCCTAGCGCCCTCCCTGCGAAGCATCAGACGCCACCCAGCCCTGGGGGGAGGCCCACGCCTGCTGGACCAACGCGGGTTCTGGGGTGCACAGCGCCAGGTTAACGCTGAAGCCTGCCCCGCTGAGCCCAGGAGCCGGGAGGCCTGCGGGCTGACCCAGAATCCGATCATGCACCTGTCCTCATGCCAGCGGCTTTGGCTGGGGTTGGTCTGAAGCCTGCACGCGGCAGTTCTTTGTTAAAGATCTGAGGGACTCCTCAGTCCTGGGGCGTCGCCGCCTGCAGCCTCTTCCAAGCCCTGCGTCCAGCGAGCGTCACAGCACAACCTGCAAAAACGGAGCTGGGCTGCAGCTGGGGCTGGCATGGACTTTCATTTCAGAGATTCGGTTTTTAAGAAGATGCATGCCTAATGTGTTCTTTTTTTTTTCCAATGATTTGTAATATACATTTTATGACTGGAAACTTTTTTGTACAACACTCCAATAAACATTTTGATTTTA