Transcript asmbl_69366

Sequence
Transcript Sequence for observation asmbl_69366 of TGE0001028:
GCTCCCTCCCCCGCGCCGTGCACGTCTTGGTTCGGGCCGGGCATAAAAGGCTTCGCGGCCCAGGGCTCACTTGGCGCTGAGAACGCGGGTCCACGCGTGTGATCGTCCGTGCGTCTAGCCTTTGCCCACGCAGCTTTCAGTCATGGCCTCCGGTAACGCGCGCATCGGAAAGCCAGCCCCTGACTTCAAGGCCACAGCGGTGGTTGATGGCGCCTTCAAAGAGGTGAAGCTGTCGGACTACAAAGGGAAGTACGTGGTCCTCTTTTTCTACCCTCTGGACTTCACTTTTGTGTGCCCCACCGAGATCATCGCGTTCAGCAACCGTGCAGAGGACTTCCGCAAGCTGGGCTGTGAAGTGCTGGGCGTCTCGGTGGACTCTCAGTTCACCCACCTGGCTTGGATCAACACCCCCCGGAAAGAGGGAGGCTTGGGCCCCCTGAACATCCCCCTGCTTGCTGACGTGACCAGACGCTTGTCTGAGGATTACGGCGTGCTGAAAACAGATGAGGGCATTGCCTACAGGGGCCTCTTTATCATCGATGGCAAGGGTGTCCTTCGCCAGATCACTGTTAATGATTTGCCTGTGGGACGCTCCGTGGATGAGGCTCTGCGGCTGGTCCAGGCCTTCCAGTACACAGACGAGCATGGGGAAGTTTGTCCCGCTGGCTGGAAGCCTGGCAGTGACACGATTAAGCCCAACGTGGATGACAGCAAGGAATATTTCTCCAAACACAATTAGGCTGGCTAACGGATAGTGAGCTTGTGCCCCTGCCTAGGTGCCTGTGCTGGGTGTCCACCTGTGCCCCCACCTGGGTGCCCTATGCTGACCCAGGAAAGGCCAGACCTGCCCCTCCAAACTCCACAGTATGGGACCCTGGAGGGCTAGGCCAAGGCCTTCTCATGCCTCCACCTAGAAGCTGAATAGTGACGCCCTCCCCCAAGCCCACCCAGCCGCACACAGGCCTAGAGGTAACCAATAAAGTATTAGGGAAAGGTG