Transcript asmbl_64523

Sequence
Transcript Sequence for observation asmbl_64523 of TGE0000843:
GGCCCTAGAGCAGCAGGTGGAGGAAATGAGGACCCAGCTGGAGGAGCTGGAAGACGAACTCCAGGCCACGGAAGATGCCAAGCTTCGTCTGGAGGTCAACATGCAGGCCATGAAGGCGCAGTTCGAGAGAGACCTGCAAACCAGGGATGAGCAGAATGAAGAGAAGAAGCGGCTGCTGATCAAACAGGTGCGGGAGCTCGAGGCGGAGCTGGAGGATGAGAGGAAACAGCGGGCGCTTGCTGTAGCTTCAAAGAAAAAGATGGAGATAGACCTGAAGGACCTCGAAGCCCAAATCGAGGCTGCGAACAAAGCTCGGGATGAGGTGATTAAGCAGCTCCGCAAGCTCCAGGCTCAGATGAAGGATTACCAACGTGAATTAGAAGAAGCTCGTGCATCCAGAGATGAGATTTTTGCTCAATCCAAAGAGAGTGAAAAGAAATTGAAGAGTCTGGAAGCAGAAATCCTTCAATTGCAGGAGGAACTTGCCTCATCTGAGCGAGCCCGCCGACACGCCGAGCAGGAGAGAGATGAGCTGGCGGACGAGATCACCAACAGCGCCTCTGGCAAGTCCGCGCTGCTGGATGAGAAGCGGCGTCTGGAAGCTCGGATCGCACAGCTGGAGGAGGAGCTGGAAGAGGAGCAGAGCAACATGGAGCTGCTCAACGACCGCTTCCGCAAGACCACTCTACAGGTGGACACACTGAACGCCGAGCTAGCAGCCGAGCGCAGCGCCGCCCAGAAGAGTGACAATGCACGCCAGCAACTGGAGCGGCAGAACAAGGAGCTGAAGGCCAAGCTGCAGGAACTCGAGGGTGCTGTCAAGTCTAAGTTCAAGGCCACCATCTCAGCCCTGGAGGCCAAGATTGGGCAGCTGGAGGAGCAGCTTGAGCAGGAAGCCAAGGAACGAGCAGCCGCCAACAAATTAGTCCGTCGCACTGAGAAGAAGCTGAAAGAAATCTTCATGCAGGTTGAGGATGAGCGTCGACACGCGGACCAGTATAAAGAGCAGATGGAGAAGGCCAACGCTCGGATGAAGCAGCTTAAACGCCAGCTGGAGGAAGCAGAAGAAGAAGCGACGCGTGCCAACGCATCTCGGCGTAAACTCCAGCGGGAACTGGATGATGCCACCGAGGCCAACGAGGGCCTGAGCCGCGAGGTCAGCACCCTGAAGAACCGGCTGAGGCGGGGTGGCCCCATCAGCTTCTCTTCCAGCCGATCTGGCCGGCGCCAGCTGCACCTTGAAGGAGCTTCCCTGGAGCTCTCCGACGATGACACAGAAAGTAAGACCAGTGATGTCAACGAGACGCAGCCACCCCAGTCAGAGTAAAGTTGCAGGAAGCCAGAGGAGGCAATACAGTGGGACAGTTAGGAATGCACCCGGGGCCTCCTGCAGATTTCGGAAATTGGCAAGCTACGGGATTCCTTCCTGAAAGATCAACTGTGTCTTAAGGCTCTCCAGCCTATGCATACTGTATCCTGCTTCAGACTTAGGTACAATTGCTCCCCTTTTTATATATAGACACACACAGGACACATATATTAAACAGATTGTTTCATCATTGCATCTATTTTCCATATAGTCATCAAGAGACCATTTTATAAAACATGGTAAGACCCTTTTTAAAACAAACTCCAGGCCCTTGGTTGCGGGTCGCTGGGTTATTGGGGCAGCGCCGTGGTCGTCACTCAGTCGCTCTGCATGCTCTCTGTCATACAGACAGGTAACCTAGTTCTGTGTTCACGTGGCCCCCGACTCCTCAGCCACATCAAGTCTCCTAGACCACTGTGGACTCTAAACTGCACTTGTCTCTCTCATTTCCTTCAAATAATGATCAATGCTATTTCAGTGAGCAAACTGTGAAAGGGGCTTTGGAAAGAGTAGGAGGGGTGGGCTGGATCGGAAGCAACACCCATTTGGGGTTACCATGTCCATCCCCCAAGGGGGGCCCTGCCCCTCGAGTCGATGGTGTCCCGCATCTACTCATGTGAACTGGCCTTGGCGAGGGCTGGTCTGTGCATAGAAGGGATAGTGGCCACACTGCAGCTGAGGCCCCAGGTGGCAGCCATGGATCATGTAGACTTCCAGATGGTCTCCCGAACCGCCTGGCTCTGCCGGCGCCCTCCTCACGTCAGGAGCAAGCAGCCGTGGACCCCTAAGCCGAGCTGGTGGAAGGCCCCTCCCCATCGCCAGCCGGGCCCTCATGCTGACCTTGCAAATTCAGCCGCTGCTTTGAGCCCAAAATGGGAATATTGGTTTTGTGTCCGAGGCTTGTTCCAAGTTTGTCAATGAGGTTTATGGAGCCTCCAGAACAGATGCCATCTTCCTGAATGTTGACATGCCAGTGGGTGTGACTCCTTCATTTTTCCTTCTCCCTTCCCTTTGGACAGTGTTACAGTGAACACTTAGCATCCTGTTTTTGGTTGGTAGTTAAGCAAACTGACATTACGGAAAGTGCCTTAGACACTACAGTACTAAGACAATGTTGAATATATCATTCGCCTCTATAACAATTTAATGTATTCAGTTTTGACTGTGCTTCATATCATGTACCTCTCTAGTCAAAGTGGTATTACAGACATTCAGTGACAATGAATCAGTGTTAATTCTAAATCCTTGATCCTCTGCAATGTGCTTGAAAACACAAACCTTTTGGGTTAAAAGCTTTAACATCTATTAGGAAGAATTTGTCCTGTGGGTTTGGAATCTTGGATTTTCCCCCTTTATGAACTGTACTGGCTGTTGACCACCAGACACCTGACCGCAAATATCTTTTCTTGTATTCCCATATTTCTAGACAATGATTTTTGTAAGACAATAAATTTATTCATTATAGATATTTGCGCCTGCTCTGTTTACTTGAAGAAAAAAGCACCCGTGGAGAATAAAGAGACCTCAATAAACAAGAATAATCATG