Transcript asmbl_63578

Sequence
Transcript Sequence for observation asmbl_63578 of TGE0056256:
CGCCCCCTTGCCCTAGCCTTCCTGTGTCCTTCCCACCCTTAGTCCCAGGCATCTGACTACCGGGAACCTCAGCCAGAGTCCGGGAGCCCCCCACCCCGTCCAGGAGCCAACAGAGCCCCCGTCTTGCTGGCGTGAGAATACATTGCTCTCCTTTGGTTGAATCAGCTGTCCCTCTTCGTGGGAAAATGAACCAGAAGACAATCCTCGTGCTCCTCATTCTGGCCGTCATCACCATCTTTGCCTTGGTTTGTGTCCTGCTGGTGGGCAGGGGTGGAGATGGGGGTGAACCCAGCCAGCTTCCCCATTGCCCCTCTGTATCTCCCAGTGCCCAGCCTTGGACACACCCTGGCCAGAGCCAGCTGTTTGCAGACCTGAGCCGAGAGGAGCTGACGGCTGTGATGCGCTTTCTGACCCAGCGGCTGGGGCCAGGGCTGGTGGATGCAGCCCAGGCCCGGCCCTCGGACAACTGTGTCTTCTCAGTGGAGTTGCAGCTGCCTCCCAAGGCTGCAGCCCTGGCTCACTTGGACAGGGGGAGCCCCCCACCTGCCCGGGAGGCACTGGCCATCGTCTTCTTTGGCAGGCAACCCCAGCCCAACGTGAGTGAGCTGGTGGTGGGGCCACTGCCTCACCCCTCCTACATGCGGGACGTGACTGTGGAGCGTCATGGAGGCCCCCTGCCCTATCACCGACGCCCCGTGCTGTTCCAAGAGTACCTGGACATAGACCAGATGATCTTCAACAGAGAGCTGCCCCAGGCTTCTGGGCTTCTCCACCACTGTTGCTTCTACAAGCACCGGGGACGGAACCTGGTGACAATGACCACGGCTCCCCGTGGTCTGCAATCAGGGGACCGGGCCACCTGGTTTGGCCTCTACTACAACATCTCGGGCGCTGGGTTCTTCCTGCACCACGTGGGCTTGGAGCTGCTAGTGAACCACAAGGCCCTTGACCCTGCCCGCTGGACTATCCAGAAGGTGTTCTATCAAGGCCGCTACTACGACAGCCTGGCCCAGCTGGAGGCCCAGTTTGAGGCCGGCCTGGTGAATGTGGTGCTGATCCCAGACAATGGCACAGGTGGGTCCTGGTCCCTGAAGTCCCCTGTGCCCCCGGGTCCAGCTCCCCCTCTACAGTTCTATCCCCAAGGCCCCCGCTTCAGTGTCCAGGGAAGTCGAGTGGCCTCCTCACTGTGGACTTTCTCCTTTGGCCTCGGAGCATTCAGTGGCCCAAGGATCTTTGACGTTCGCTTCCAAGGAGAAAGACTAGTTTATGAGATAAGCCTCCAAGAGGCCTTGGCCATCTATGGTGGAAATTCCCCAGCAGCAATGACGACCCGCTATGTGGATGGAGGCTTTGGCATGGGCAAGTACACCACGCCCCTGACCCGTGGGGTGGACTGCCCCTACTTGGCCACCTACGTGGACTGGCACTTCCTTTTGGAGTCCCAGGCCCCCAAGACAATACGTGATGCCTTTTGTGTGTTTGAACAGAACCAGGGCCTCCCCCTGCGGCGACACCACTCAGATCTCTACTCGCACTACTTTGGGGGTCTTGCGGAAACGGTGCTGGTCGTCAGATCTATGTCCACCTTGCTCAACTATGACTATGTGTGGGATACGGTCTTCCACCCCAGTGGGGCCATAGAAATACGATTCTATGCCACGGGCTACATCAGCTCGGCATTCCTCTTTGGTGCTACTGGGAAGTACGGGAACCAAGTGTCAGAGCACACCCTGGGCACGGTCCACACCCACAGCGCCCACTTCAAGGTGGATCTGGATGTAGCAGGACTGGAGAACTGGGTCTGGGCCGAGGATATGGTCTTTGTCCCCATGGCTGTGCCCTGGAGCCCTGAGCACCAGCTGCAGAGGCTGCAGGTGACCCGGAAGCTGCTGGAGATGGAGGAGCAGGCCGCCTTCCTCGTGGGAAGCGCCACCCCTCGCTACCTGTACCTGGCCAGCAACCACAGCAACAAGTGGGGTCACCCCCGGGGCTACCGCATCCAGATGCTCAGCTTTGCTGGAGAGCCGCTGCCCCAAAACAGCTCCATGGCGAGAGGCTTCAGCTGGGAGAGGTACCAGCTGGCTGTGACCCAGCGGAAGGAGGAGGAGCCCAGTAGCAGCAGCGTTTTCAATCAGAATGACCCTTGGGCCCCCACTGTGGATTTCAGTGACTTCATCAACAATGAGACCATTGCTGGAAAGGATTTGGTGGCCTGGGTGACAGCTGGTTTTCTGCATATCCCACATGCAGAGGACATTCCTAACACAGTGACTGTGGGGAACGGCGTGGGCTTCTTCCTCCGACCCTATAACTTCTTTGACGAAGACCCCTCCTTCTACTCTGCCGACTCCATCTACTTCCGAGGGGACCAGGATGCTGGGGCCTGCGAGGTCAACCCCCTAGCTTGCCTGCCCCAGGCTGCTGCCTGTGCCCCCGACCTCCCTGCCTTCTCCCACGGGGGCTTCTCTCACAACTAGGCGGTCCTGGGATGGGGCATGTGGCCAAGGGCTCCAGGGCCAGGGTGTGAGGGATGGGGAGCAGCTGGGCACTGGGCCGGCAGCCTGGTTCCCTCTTTCCTGTGCCAGGACTCTCTTTCTTCCACTACCCTCCCTCGCATCCGCCTCTGAGCCAGGAGCCTCCTGACCCTGTGATGCCTGACACAGGGGACACTGAACCTTGTTGATGCCAGCTGTACTGAGTTCTCATCCACAGAGGCCAGGCATGGCCCAGCCTGGAGCCGTGGCCGAGGGCTTCCCTAGATGGTTCCCTTTGTTGCTGTCTGGCTTTCCCGAATCTTTTTAGGCCACCTCCAAGGACTCTAAAAGGGGGCTATTCCCTGGAGACCCCAGAGTAGGGTTGCCAGTCCTGCAAGTCCATAGCTGAGCTGGAAAGGATGCTTCTGCTCACATTCCCTCTCATCCAGGTCCTTTCCTTCTCGTCTTCCTCTCTCTCACCTACTTCCTCCTCCTCCTCCTGTTCCTGCCTTCTCTTCTATCCTGCAATTTCTCCCGAATCCTGAGGGGATATCCCTATGTCCCAGCCCCTGGTACTCCCCCAGCCCTCAGTTTTCAGTCAAGTTCCGTCTCCTCTCCAGCCCTATGGAAGTCTCAAGGTCACGGGACCCCTAATCAGAGTGGCCAATCCCTGTGTGTCGTTCCCTTGTGTCTGTTGCTTATTGGGAGTAGGAGTTGCTCCTACCCCTGTCCTGGGGCTGGGTGTGTTTCAGGACAGCTGCTTCTGTGCATTTGTGTCTGCCTGCCTCATGCTCTCTATAGAGGAGGATGGTCATCGTGACAGCAGCAGCTCAAGTTAGCATTTCAAGTGATTTGGGGGTGCAATGATAATGAAGAATGGCCATTTTGTACCAGGGCTCTGTATTCTGCAACAGCCTGTTTGGGAGGCTGGAGTGGAAACAAAGGGTGGGCATCAAAGATGAGAAGCCAAAGCCCCTACAACTCCAGCCACCCAGCCAGGAGGGGCTGTCCAATCACATTCAGGCATGCGAATGAGCTGGGCCCTGGGTGAGGTGGGGGTCTGGCCTAGTGGGGAGGGGCCTGGCCTGGGTGGGGCAGGGCCTGGCCTGGTCCAGGCTTGGGCTCCATTCCCATCACTGCTGTCCCTCCTGAGGTCTGGATTGGGGATGGGGACAAAGAAATAGCAAGAGATGAGAAACAACAGAAACTTTTTTCTCTAAAGGACTGGTTAAATCAATTCTGATACAGCCTTACAATACAATAGTATGCAGCTAAAAAATAATTGTATGTCTTTATATACTAATATGTAATAATCTTCAGGTGAAAAAGGCAAGCCACAGAAATGTGTATAGCGCACTTCCCATTTGTGTTTCAGAAAGGAGTAGAATATAAACACATAATTGCTTATGTATGCCTATTCAGAATAAATGGGTAACACTGATTACTTTTGGGAGGGGAACCAGTAGGTTGAGGACAGGAGAGGGAAGGGTCTTAACACTTACACCCTTTTGTACATTTTGAATTTTGAACCATGTGACTGTATTACCTATTCAAAATAAACAATAAATGGGCCCAAACAGGAA