Transcript asmbl_63007

Sequence
Transcript Sequence for observation asmbl_63007 of TGE0057302:
GCCTGGGGATGCCAGCAGAAGTCCTGGCAAGTCACAGGAAGATGCTGGCTGGGAAGTCAGGGCCTGCTGAGCGCTAAACCAGAACCCGAGCCTGGCAGGCTCTCAAAGACGGGATGCTTGTCGTCGAGTCTCATACGCTAACCTCTGCTCCGCCTCTTCTCAGAGCTGCGCATAAAATCCAGCTTTGTGGCACCTCTGGAAAAGTCATATGGGACCAGGCCCAGAGTCCTGACGGGCAACCCTCGCTTGGACCTGCAAGAGATCAACAACTGGGTGCAGGCGCAGATGAAAGGGAAGCTCGCCAGGTCCACAAAGGAAATTCCCGATGAGATCAGCATTCTCCTTCTCGGTGTGGCGCACTTCAAGGGGCAGTGGGTAACAAAGTTTGACTCCAGAAAGACTTCCCTCGAGGATTTCTACTTGGATGAAGAGAGGACCGTGAGGGTCCCCATGATGTCGGACCCTAAGGCTGTTTTACGCTATGGCTTGGATTCAGATCTCAGCTGCAAGATTGCCCAGCTGCCCTTGACCGGAAGCATGAGTATCATCTTCTTCCTGCCCCTGAAAGTGACCCAGAATTTGACCTTGATAGAGGAGAGCCTCACCTCCGAGTTCATTCATGACATAGACCGAGAACTGAAGACCGTGCAGGCGGTCCTCACTGTCCCCAAGCTGAAGCTGAGTTATGAAGGCGAAGTCACCAAGTCCCTGCAGGAGATGAAGCTGCAATCCTTGTTTGATTCACCAGACTTTAGCAAGATCACAGGCAAACCCATCAAGCTGACTCAGGTGGAACACCGGGCTGGCTTTGAGTGGAACGAGGATGGGGCGGGAACCACCCCCAGCCCAGGGCTGCAGCCTGCCCACCTCACCTTCCCGCTGGACTATCACCTTAACCAGCCTTTCATCTTCGTACTGAGGGACACAGACACAGGGGCCCTTCTCTTCATTGGCAAGATTCTGGACCCCAGGGGCCCCTAATATCCCAGTTTAATATTCCAATACCCTAGAAGAAAACCCGAGGGACAGCAGATTCCACAGGACACGAAGGCTGCCCCTGTAAGGTTTCAATGCATACAATAAAAGAGCTTTATCCCTA