Transcript asmbl_54245

Sequence
Transcript Sequence for observation asmbl_54245 of TGE0000590:
ACGCATGCGACTTCCCGGTGGCCATCTTTACTGTGGGCTGAAGCCTGTGCGCTTACTCGCGCATGTGCAAGCCTTCCCTCGCTTTCCTCTTCCAAGTAGCCTTGCCTAGAGCGGAGCCTCCCGCGCCATTTCTGTGCGCCTGCGTAGCGTGACCCTGCGCAGCCTGGGAGGCGGGTCTTAGCTCCAGGTGCGTACGGCATCTGACTTGACGTGGCCCACAACTGAAAGGTCTGGGGAGAAGGCGCCGTGTCCGGGTGTGGAGAGGGGCGTCGTGGAAGCGAGAAGAGTGGCCCGTCCCTCTCCTCCCCCTTTCCCTCTTTCGGAAAGTGGTTTCTGCGGGGCCCGGGAGCCTCGGAGTACCGAACCTCGATCTCCGGGGCGGGGTCCTTGGTGGGGACTGAGCGCCCCCTCCCGGGGACGGGCGGTCTGGCCGCGGAGTCCCCTGCGGGAGCGTGATTGGCTGGAAACGGTCCCGAACCCCCAGGGGAGCCCGATCCCTGGGGGACCCTGGCTTCGGACTCCAGTATCTGTCGTCGCAGGGTCCCTGCCCTAGTGGCCTATGTCCCTTGCTCGGGGCCATGGAGACACTGCGGCCAGTACGGCGGCGCCTCTGTCTGAAGAAGGGGAAGTGACCTCCGGCCTCCAGGCTCTGGCCGTGGAGGATACCGGAGGCCCCTCTGCCTCGGCCGGTAAGGCCGAGGACGAGGGGGAAGGAGGCCGAGAGGAGACCGAGCGTGAGGGGTCCGGGGGCGAGGAGGCGCAGGGAGAAGTCCCCAGCGCTGGGGGAGAAGAGCCTGCCGAGGAGGACTCCGAGGACTGGTGCGTGCCCTGCAGCGACGAGGAGGTGGAGCTGCCTGCGGATGGGCAGCCCTGGATGCCCCCGCCCTCCGAAATCCAGCGGCTCTATGAACTGCTGGCTGCCCACGGTACTCTGGAGCTGCAAGCCGAGATCCTGCCCCGCCGGCCTCCCACGCCGGAGGCCCAGAGCGAAGAGGAGAGATCCGATGAGGAGCCGGAGGCCAAAGAAGAGGAAGAGGAAAAACCACACATGCCCACGGAATTTGATTTTGATGATGAGCCAGTGACACCAAAGGACTCCCTGATTGACCGGAGACGCACCCCAGGAAGCTCAGCCCGGAGCCAGAAACGGGAGGCCCGCCTGGACAAGGTGCTGTCGGACATGAAGAGACACAAGAAGCTGGAGGAGCAGATCCTTCGTACCGGGAGGGACCTCTTCAGCCTGGACTCGGAGGACCCCAGCCCCGCCAGCCCCCCACTCCGATCCTCCGGGAGTAGTCTCTTCCCTCGGCAGCGGAAATACTGATTCCCACTGCTCCTGCCTCTAGGGTGCAGTGTCCGTACCTGCTGGAGCCTGGGCCCTCCTTCCCCAGCCCAGACATTGAGAAACTTGGGAAGAAGAGAGAAACCTCAAGCTCCCAAACAGCACGTTGCGGGAAAGAGGAAGAGAGAGTGTGAGTGTGTGTGTGTGTTTTTTCTATTGAACACCTGTAGAGTGTGTGTGTGTGTTTTCTATTGAACACCTATAGAGAGAGTGTGTGTGTTTTCTATTGAACATCTATATAGAGAGAGTGTGTGAGTGTGTGTTTTCTATTGAACACCTATTCAGAGACCTGGACTGAATTTTCTGAGTCTGAAATAAAAGATGCAGAGCTATCATCTCTTAAAAGGAGGGGCTGTAGCTGTAGCTCAACAGTTAGGCCCCACTTGAAGGGAGAGGCAGAATTGTACTCACCCAGATTGGAAAATGAAAGCCAGATGGGTAGAGGTGCCCTCAGTTAGCACCTGTCCCATCTCGGGCCCTCCAACTCCTCCCAGTCCCACTCCAGTGCAGCCAGCTGGCTCCAAGGTAGAAACCCATGAGCACTCAGGGAGCAGTGTGCCTTCAGCTGCAGCAGAAGCAGCCCGGAGGATAAAATGAGAACCAGCTGCACACGGGCCCTTTAACTCCCAAGCCCCACCCCTGGGCTTGGCCTGCCTTGCCCTGCCGGGAAGTGATCCCCAAGGCAGGGTGAGAGTTCCCCATCTGAGGCGTTTGTTGCAGCTACCTGCACTTCTAGATTCATCTTCTTGTGAGCCCTGGGCTTAGGAGTCACCATGGCAACTGAAGAGTTCATCATCCGCATCCCCCCATACCACTATATCCATGTGCTGGACCAGAACAGCAACGTGTCCCGTGTGGAGGTCGGGCCAAAGACCTACATCCGGCAGGACAATGAGAGGGTACTGTTTGCCCCCATGCGCATGGTGACCGTCCCCCCACGTCACTACTGCACAGTGGCCAACCCTGTGTCTCGGGATGCCCAGGGCTTGGTGCTGTTTGATGTCACAGGGCAAGTTCGGCTTCGCCACGCTGACCTCGAGATCCGGCTGGCCCAGGACCCCTTCCCCCTGTACCCAGGGGAGGTGCTGGAAAAGGACATCACACCCCTGCAGGTGGTTCTGCCCAACACTGCCCTCCATCTAAAGGCGCTGCTTGATTTTGAGGATAAAGATGGAGACAAGGTGGTGGCAGGAGATGAGTGGCTTTTCGAGGGACCTGGCACGTACATCCCCCGGAAGGAAGTGGAGGTCGTGGAGATCATTCAGGCCACCATCATCAGGCAGAACCAGGCTCTGCGGCTCAGGGCCCGCAAGGAGTGCTGGGACCGGGACGGCAAGGAGAGGGTGACAGGGGAAGAATGGCTGGTCACCACAGTAGGGGCGTACCTCCCAGCGGTGTTTGAGGAGGTTCTGGATTTGGTGGACGCCGTCATCCTTACGGAAAAGACAGCCCTGCACCTCCGGGCTCGGCGGAACTTCCGGGACTTCAGGGGAGTGTCCCGCCGCACTGGGGAGGAGTGGCTGGTAACAGTGCAGGACACAGAGGCCCACGTGCCAGATGTCCACGAGGAGGTGCTGGGGGTTGTGCCCATCACCACCCTGGGCCCCCACAACTACTGCGTGATTCTCGACCCTGTCGGACCGGATGGCAAGAATCAGCTGGGGCAGAAGCGCGTGGTCAAGGGAGAGAAGTCTTTTTTCCTCCAGCCAGGAGAGCAGCTGGAACAAGGCATCCAGGATGTGTATGTGCTGTCGGAGCAGCAGGGGCTGCTGCTGAGGGCCCTGCAGCCCCTGGAGGAGGGGGAGGATGAGGAGAAGGTCTCACACCAGGCTGGGGACCACTGGCTCATCCGCGGACCCCTGGAGTATGTGCCATCTGCCAAAGTGGAGGTGGTGGAGGAGCGCCAGGCCATCCCTCTAGACGAGAACGAGGGCATCTATGTGCAGGATGTCAAGACCGGAAAGGTGCGCGCTGTGATTGGAAGCACCTACATGCTGACCCAGGACGAAGTCCTGTGGGAGAAAGAGCTGCCTCCCGGGGTGGAGGAGCTGCTGAACAAGGGGCAGGACCCTCTGGCAGACAGGGGTGAGAAGGACACAGCTAAGAGCCTCCAGCCCTTGGCGCCCCGGAACAAGACCCGTGTGGTCAGCTACCGCGTGCCCCACAACGCTGCGGTGCAGGTGTACGACTACCGAGAGAAGCGAGCCCGCGTGGTCTTCGGGCCTGAGCTGGTGTCGCTGGGTCCTGAGGAGCAGTTCACAGTGTTGTCCCTCTCAGCTGGGCGGCCCAAGCGTCCCCATGCCCGCCGTGCGCTCTGCCTGCTGCTGGGGCCTGACTTCTTCACAGACGTCATCACCATCGAAACGGCGGATCATGCCAGGCTGCAACTGCAGCTGGCCTACAACTGGCACTTTGAGGTGAATGACCGGAAGGACCCCCAAGAGACGGCCAAGCTCTTTTCAGTGCCAGACTTTGTAGGTGATGCCTGCAAAGCCATCGCATCCCGGGTGCGGGGGGCCGTGGCCTCTGTCACTTTCGATGACTTCCATAAGAACTCAGCCCGCATCATTCGCACTGCTGTCTTTGGCTTTGAGACCTCGGAAGCGAAGGGCCCCGATGGCATGGCCCTGCCCAGGCCCCGGGACCAGGCTGTCTTCCCCCAAAACGGGCTGGTGGTCAGCAGTGTGGACGTGCAGTCAGTGGAGCCTGTGGATCAGAGGACCCGGGACGCCCTGCAACGCAGCGTCCAGCTGGCCATCGAGATCACCACCAACTCCCAGGAAGCGGCGGCCAAGCATGAGGCTCAGAGACTGGAGCAGGAAGCCCGCGGCCGGCTTGAGCGGCAGAAGATCCTGGACCAGTCAGAAGCCGAGAAAGCTCGCAAGGAACTTTTGGAGCTGGAGGCTCTGAGCATGGCCGTGGAGAGCACCGGGACTGCCAAGGCGGAGGCCGAGTCCCGTGCGGAGGCAGCCCGGATTGAGGGAGAAGGGTCCGTGCTGCAGGCCAAGCTAAAAGCACAGGCCTTGGCCATTGAAACGGAGGCTGAGCTCCAGAGGGTCCAGAAGGTCCGAGAGCTGGAACTGGTCTATGCCCGGGCCCAGCTGGAGCTGGAGGTGAGCAAGGCTCAGCAGCTGGCTGAGGTGGAGGTGAAGAAGTTCAAGCAGATGACAGAGGCCATAGGCCCCAGCACCATCAGGGACCTTGCTGTGGCTGGGCCTGAGATGCAGGTAAAACTGCTCCAGTCCCTGGGCCTGAAATCAACCCTCATCACCGATGGCTCCACTCCCATCAACCTCTTCAACACAGCCTTTGGGCTGCTGGGGATGGGGCCCGAGGGTCAGCCCCTGGGCAGAAGGGTGGCCAGTGGGCCCAGCCCTGGGGAGGGGATATCCCCCCAGTCTGCTCAGGCCCCTCAAGCTCCTGGAGACAACCACGTGGTGCCTGTACTGCGCTAACTCCTGATTAATACAATGGAAGTTTCTGGGCATTTACAATTTCAACA