Transcript asmbl_53614

Sequence
Transcript Sequence for observation asmbl_53614 of TGE0000626:
CGGTGACCTCCGTGCGGCCGGGTGCGGGCGGAGTCTTCCTCGATCCCGTGGTGCTCCGCGGCGCGGCCTTGCTCTCTTCCGGTCGCGGGACACCGGGTGTAGAGGGCGGTCGCGGCGGGCAGTGGCGGCAGAATGTTGGCTACCAGGGTATTTAGCCTAGTTGGCAAGCGAGCAATTTCCACCTCTGTGTGTGTACGAGCTCATGAAAGTGTTGTGAAGAGCGAAGACTTTTCGCTCCCAGCTTATATGGATCGGCGTGACCACCCCTTGCCGGAGGTGGCCCATGTCAAGCACCTGTCTGCCAGCCAGAAGGCATTGAAGGAGAAGGAGAAGGCCTCCTGGAGCAGCCTCTCCATGGATGAGAAAGTCGAGTTGTATCGCATTAAGTTCAAGGAGAGCTTTGCTGAGATGAACAGGGGCTCGAACGAGTGGAAGACGGTTGTGGGCGGTGCCATGTTCTTCATCGGTTTCACCGCGCTCGTTATCATGTGGCAGAAGCACTATGTGTACGGCCCCCTCCCGCAAAGCTTTGACAAAGAGTGGGTGGCCAAGCAGACCAAGAGGATGCTGGACATGAAGGTGAACCCCATCCAGGGCTTAGCCTCCAAGTGGGACTACGAAAAGAACGAGTGGAAGAAGTGAGAGATGCTGGCCTGCGCCTGCACCTGCGCCTGGCTCTGTCACCGCCATGCAACTCCATGCCTATTTACTGGAAACCTGTTATGCCAAACAGTTGTACCACTGCTAATAAATGACCAGTTTACCTG