Transcript asmbl_53316

Sequence
Transcript Sequence for observation asmbl_53316 of TGE0000590:
ACGCATGCGACTTCCCGGTGGCCATCTTTACTGTGGGCTGAAGCCTGTGCGCTTACTCGCGCATGTGCAAGCCTTCCCTCGCTTTCCTCTTCCAAGTAGCCTTGCCTAGAGCGGAGCCTCCCGCGCCATTTCTGTGCGCCTGCGTAGCGTGACCCTGCGCAGCCTGGGAGGCGGGTCTTAGCTCCAGGTGCGTACGGCATCTGACTTGACGTGGCCCACAACTGAAAGGTCTGGGGAGAAGGCGCCGTGTCCGGGTGTGGAGAGGGGCGTCGTGGAAGCGAGAAGAGTGGCCCGTCCCTCTCCTCCCCCTTTCCCTCTTTCGGAAAGTGGTTTCTGCGGGGCCCGGGAGCCTCGGAGTACCGAACCTCGATCTCCGGGGCGGGGTCCTTGGTGGGGACTGAGCGCCCCCTCCCGGGGACGGGCGGTCTGGCCGCGGAGTCCCCTGCGGGAGCGTGATTGGCTGGAAACGGTCCCGAACCCCCAGGGGAGCCCGATCCCTGGGGGACCCTGGCTTCGGACTCCAGTATCTGTCGTCGCAGGGTCCCTGCCCTAGTGGCCTATGTCCCTTGCTCGGGGCCATGGAGACACTGCGGCCAGTACGGCGGCGCCTCTGTCTGAAGAAGGGGAAGTGACCTCCGGCCTCCAGGCTCTGGCCGTGGAGGATACCGGAGGCCCCTCTGCCTCGGCCGGTAAGGCCGAGGACGAGGGGGAAGGAGGCCGAGAGGAGACCGAGCGTGAGGGGTCCGGGGGCGAGGAGGCGCAGGGAGAAGTCCCCAGCGCTGGGGGAGAAGAGCCTGCCGAGGAGGACTCCGAGGACTGGTGCGTGCCCTGCAGCGACGAGGAGGTGGAGCTGCCTGCGGATGGGCAGCCCTGGATGCCCCCGCCCTCCGAAATCCAGCGGCTCTATGAACTGCTGGCTGCCCACGGTACTCTGGAGCTGCAAGCCGAGATCCTGCCCCGCCGGCCTCCCACGCCGGAGGCCCAGAGCGAAGAGGAGAGATCCGATGAGGAGCCGGAGGCCAAAGAAGAGGAAGAGGAAAAACCACACATGCCCACGGAATTTGATTTTGATGATGAGCCAGTGACACCAAAGGACTCCCTGATTGACCGGAGACGCACCCCAGGAAGCTCAGCCCGGAGCCAGAAACGGGAGGCCCGCCTGGACAAGGTGCTGTCGGACATGAAGAGACACAAGAAGCTGGAGGAGCAGATCCTTCGTACCGGGAGGGACCTCTTCAGCCTGGACTCGGAGGACCCCAGCCCCGCCAGCCCCCCACTCCGATCCTCCGGGAGTAGTCTCTTCCCTCGGCAGCGGAAATACTGATTCCCACTGCTCCTGCCTCTAGGGTGCAGTGTCCGTACCTGCTGGAGCCTGGGCCCTCCTTCCCCAGCCCAGACATTGAGAAACTTGGGAAGAAGAGAGAAACCTCAAGCTCCCAAACAGCACGTTGCGGGAAAGAGGAAGAGAGAGTGTGAGTGTGTGTGTGTGTTTTTTCTATTGAACACCTGTAGAGTGTGTGTGTGTGTTTTCTATTGAACACCTATAGAGAGAGTGTGTGTGTTTTCTATTGAACATCTATATAGAGAGAGTGTGTGAGTGTGTGTTTTCTATTGAACACCTATTCAGAGACCTGGACTGAATTTTCTGAGTCTGAAATAAAAGATGCAGAGCTATCATCTCTTAAAAGGAGGGGCTGTAGCTGTAGCTCAACAGTTAGGCCCCACTTGAAGGGAGAGGCAGAATTGTACTCACCCAGATTGGAAAATGAAAGCCAGATGGGTAGAGGTGCCCTCAGTTAGCACCTGTCCCATCTCGGGCCCTCCAACTCCTCCCAGTCCCACTCCAGTGCAGCCAGCTGGCTCCAAGGTAGAAACCCATGAGCACTCAGGGAGCAGTGTGCCTTCAGCTGCAGCAGAAGCAGCCCGGAGGATAAAATGAGAACCAGCTGCACACGGGCCCTTTAACTCCCAAGCCCCACCCCTGGGCTTGGCCTGCCTTGCCCTGCCGGGAAGTGATCCCCAAGGCAGGGTGAGAGTTCCCCATCTGAGGCGTTTGTTGCAGCTACCTGCACTTCTAGATTCATCTTCTTGTGAGCCCTGGGCTTAGGAGTCACCATGGCAACTGAAGAGTTCATCATCCGCATCCCCCCATACCACTATATCCATGTGCTGGACCAGAACAGCAACGTGTCCCGTGTGGAGGTCGGGCCAAAGACCTACATCCGGCAGGACAATGAGAGGGTACTGTTTGCCCCCATGCGCATGGTGACCGTCCCCCCACGTCACTACTGCACAGTGGCCAACCCTGTGTCTCGGGATGCCCAGGGCTTGGTGCTGTTTGATGTCACAGGGCAAGTTCGGCTTCGCCACGCTGACCTCGAGATCCGGCTGGCCCAGGACCCCTTCCCCCTGTACCCAGGGGAGGTGCTGGAAAAGGACATCACACCCCTGCAGGTGGTTCTGCCCAACACTGCCCTCCATCTAAAGGCGCTGCTTGATTTTGAGGATAAAGATGGAGACAAGGTGGTGGCAGGAGATGAGTGGCTTTTCGAGGGACCTGGCACGTACATCCCCCGGAAGGAAGTGGAGGTCGTGGAGATCATTCAGGCCACCATCATCAGGCAGAACCAGGCTCTGCGGCTCAGGGCCCGCAAGGAGTGCTGGGACCGGGACGGCAAGGAGAGGGTGACAGGGGAAGAATGGCTGGTCACCACAGTAGGGGCGTACCTCCCAGCGGTGTTTGAGGAGGTTCTGGATTTGGTGGACGCCGTCATCCTTACGGAAAAGACAGCCCTGCACCTCCGGGCTCGGCGGAACTTCCGGGACTTCAGGGGAGTGTCCCGCCGCACTGGGGAGGAGTGGCTGGTAACAGTGCAGGACACAGAGGCCCACGTGCCAGATGTCCACGAGGAGGTGCTGGGGGTTGTGCCCATCACCACCCTGGGCCCCCACAACTACTGCGTGATTCTCGACCCTGTCGGACCGGATGGCAAGAATCAGCTGGGGCAGAAGCGCGTGGTCAAGGGAGAGAAGTCTTTTTTCCTCCAGCCAGGAGAGCAGCTGGAACAAGGCATCCAGGATGTGTATGTGCTGTCGGAGCAGCAGGGGCTGCTGCTGAGGGCCCTGCAGCCCCTGGAGGAGGGGGAGGATGAGGAGAAGGTCTCACACCAGGCTGGGGACCACTGGCTCATCCGCGGACCCCTGGAGTATGTGCCATCTGCCAAAGTGGAGGTGGTGGAGGAGCGCCAGGCCATCCCTCTAGACGAGAACGAGGGCATCTATGTGCAGGATGTCAAGACCGGAAAGGTGCGCGCTGTGATTGGAAGCACCTACATGCTGACCCAGGACGAAGTCCTGTGGGAGAAAGAGCTGCCTCCCGGGGTGGAGGAGCTGCTGAACAAGGGGCAGGACCCTCTGGCAGACAGGGGTGAGAAGGACACAGCTAAGAGCCTCCAGCCCTTGGCGCCCCGGAACAAGACCCGTGTGGTCAGCTACCGCGTGCCCCACAACGCTGCGGTGCAGGTGTACGACTACCGAGAGAAGCGAGCCCGCGTGGTCTTCGGGCCTGAGCTGGTGTCGCTGGGTCCTGAGGAGCAGTTCACAGTGTTGTCCCTCTCAGCTGGGCGGCCCAAGCGTCCCCATGCCCGCCGTGCGCTCTGCCTGCTGCTGGGGCCTGACTTCTTCACAGACGTCATCACCATCGAAACGGCGGATCATGCCAGGCTGCAACTGCAGCTGGCCTACAACTGGCACTTTGAGGTGAATGACCGGAAGGACCCCCAAGAGACGGCCAAGCTCTTTTCAGTGCCAGACTTTGTAGGTGATGCCTGCAAAGCCATCGCATCCCGGGTGCGGGGGGCCGTGGCCTCTGTCACTTTCGATGACTTCCATAAGAACTCAGCCCGCATCATTCGCACTGCTGTCTTTGGCTTTGAGACCTCGGAAGCGAAGGGCCCCGATGGCATGGCCCTGCCCAGGCCCCGGGACCAGGCTGTCTTCCCCCAAAACGGGCTGGTGGTCAGCAGTGTGGACGTGCAGTCAGTGGAGCCTGTGGATCAGAGGACCCGGGACGCCCTGCAACGCAGCGTCCAGCTGGCCATCGAGATCACCACCAACTCCCAGGAAGCGGCGGCCAAGCATGAGGCTCAGAGACTGGAGCAGGAAGCCCGCGGCCGGCTTGAGCGGCAGAAGATCCTGGACCAGTCAGAAGCCGAGAAAGCTCGCAAGGAACTTTTGGAGCTGGAGGCTCTGAGCATGGCCGTGGAGAGCACCGGGACTGCCAAGGCGGAGGCCGAGTCCCGTGCGGAGGCAGCCCGGATTGAGGGAGAAGGGTCCGTGCTGCAGGCCAAGCTAAAAGCACAGGCCTTGGCCATTGAAACGGAGGCTGAGCTCCAGAGGGTCCAGAAGGTCCGAGAGCTGGAACTGGTCTATGCCCGGGCCCAGCTGGAGCTGGAGGTGAGCAAGGCTCAGCAGCTGGCTGAGGTGGAGGTGAAGAAGTTCAAGCAGATGACAGAGGCCATAGGCCCCAGCACCATCAGGGACCTTGCTGTGGCTGGGCCTGAGATGCAGGTAAAACTGCTCCAGTCCCTGGGCCTGAAATCAACCCTCATCACCGATGGCTCCACTCCCATCAACCTCTTCAACACAGCCTTTGGGCTGCTGGGGATGGGGCCCGAGGGTCAGCCCCTGGGCAGAAGGGTGGCCAGTGGGCCCAGCCCTGGGGAGGGGATATCCCCCCAGTCTGCTCAGGCCCCTCAAGCTCCTGGAGACAACCACGTGGTGCCTGTACTGCGCTAACTCCTGATTAATACAATGGAAGTTTCTGGGCATTTACAATTTCAACA