Transcript asmbl_53292

Sequence
Transcript Sequence for observation asmbl_53292 of TGE0000590:
ACGCATGCGACTTCCCGGTGGCCATCTTTACTGTGGGCTGAAGCCTGTGCGCTTACTCGCGCATGTGCAAGCCTTCCCTCGCTTTCCTCTTCCAAGTAGCCTTGCCTAGAGCGGAGCCTCCCGCGCCATTTCTGTGCGCCTGCGTAGCGTGACCCTGCGCAGCCTGGGAGGCGGGTCTTAGCTCCAGGTGCGTACGGCATCTGACTTGACGTGGCCCACAACTGAAAGGTCTGGGGAGAAGGCGCCGTGTCCGGGTGTGGAGAGGGGCGTCGTGGAAGCGAGAAGAGTGGCCCGTCCCTCTCCTCCCCCTTTCCCTCTTTCGGAAAGTGGTTTCTGCGGGGCCCGGGAGCCTCGGAGTACCGAACCTCGATCTCCGGGGCGGGGTCCTTGGTGGGGACTGAGCGCCCCCTCCCGGGGACGGGCGGTCTGGCCGCGGAGTCCCCTGCGGGAGCGTGATTGGCTGGAAACGGTCCCGAACCCCCAGGGGAGCCCGATCCCTGGGGGACCCTGGCTTCGGACTCCAGTATCTGTCGTCGCAGGGTCCCTGCCCTAGTGGCCTATGTCCCTTGCTCGGGGCCATGGAGACACTGCGGCCAGTACGGCGGCGCCTCTGTCTGAAGAAGGGGAAGTGACCTCCGGCCTCCAGGCTCTGGCCGTGGAGGATACCGGAGGCCCCTCTGCCTCGGCCGGTAAGGCCGAGGACGAGGGGGAAGGAGGCCGAGAGGAGACCGAGCGTGAGGGGTCCGGGGGCGAGGAGGCGCAGGGAGAAGTCCCCAGCGCTGGGGGAGAAGAGCCTGCCGAGGAGGACTCCGAGGACTGGTGCGTGCCCTGCAGCGACGAGGAGGTGGAGCTGCCTGCGGATGGGCAGCCCTGGATGCCCCCGCCCTCCGAAATCCAGCGGCTCTATGAACTGCTGGCTGCCCACGGTACTCTGGAGCTGCAAGCCGAGATCCTGCCCCGCCGGCCTCCCACGCCGGAGGCCCAGAGCGAAGAGGAGAGATCCGATGAGGAGCCGGAGGCCAAAGAAGAGGAAGAGGAAAAACCACACATGCCCACGGAATTTGATTTTGATGATGAGCCAGTGACACCAAAGGACTCCCTGATTGACCGGAGACGCACCCCAGGAAGCTCAGCCCGGAGCCAGAAACGGGAGGCCCGCCTGGACAAGGTGCTGTCGGACATGAAGAGACACAAGAAGCTGGAGGAGCAGATCCTTCGTACCGGGAGGGACCTCTTCAGCCTGGACTCGGAGGACCCCAGCCCCGCCAGCCCCCCACTCCGATCCTCCGGGAGTAGTCTCTTCCCTCGGCAGCGGAAATACTGATTCCCACTGCTCCTGCCTCTAGGGTGCAGTGTCCGTACCTGCTGGAGCCTGGGCCCTCCTTCCCCAGCCCAGACATTGAGAAACTTGGGAAGAAGAGAGAAACCTCAAGCTCCCAAACAGCACGTTGCGGGAAAGAGGAAGAGAGAGTGTGAGTGTGTGTGTGTGTTTTTTCTATTGAACACCTGTAGAGTGTGTGTGTGTGTTTTCTATTGAACACCTATAGAGAGAGTGTGTGTGTTTTCTATTGAACATCTATATAGAGAGAGTGTGTGAGTGTGTGTTTTCTATTGAACACCTATTCAGAGACCTGGACTGAATTTTCTGAGTCTGAAATAAAAGATGCAGAGCTATCATCTCTTAAAAGGAGGGGCTGTAGCTGTAGCTCAACAGTTAGGCCCCACTTGAAGGGAGAGGCAGAATTGTACTCACCCAGATTGGAAAATGAAAGCCAGATGGGTAGAGGTGCCCTCAGTTAGCACCTGTCCCATCTCGGGCCCTCCAACTCCTCCCAGTCCCACTCCAGTGCAGCCAGCTGGCTCCAAGGTAGAAACCCATGAGCACTCAGGGAGCAGTGTGCCTTCAGCTGCAGCAGAAGCAGCCCGGAGGATAAAATGAGAACCAGCTGCACACGGGCCCTTTAACTCCCAAGCCCCACCCCTGGGCTTGGCCTGCCTTGCCCTGCCGGGAAGTGATCCCCAAGGCAGGGTGAGAGTTCCCCATCTGAGGCGTTTGTTGCAGCTACCTGCACTTCTAGATGCTCCCCAGGTTCATCCTGTGTCGTCTCCCCCACCTACCAGTCATCTTCTTGTGAGCCCTGGGCTTAGGAGTCACCATGGCAACTGAAGAGTTCATCATCCGCATCCCCCCATACCACTATATCCATGTGCTGGACCAGAACAGCAACGTGTCCCGTGTGGAGGTCGGGCCAAAGACCTACATCCGGCAGGACAATGAGAGGGTACTGTTTGCCCCCATGCGCATGGTGACCGTCCCCCCACGTCACTACTGCACAGTGGCCAACCCTGTGTCTCGGGATGCCCAGGGCTTGGTGCTGTTTGATGTCACAGGGCAAGTTCGGCTTCGCCACGCTGACCTCGAGATCCGGCTGGCCCAGGACCCCTTCCCCCTGTACCCAGGGGAGGTGCTGGAAAAGGACATCACACCCCTGCAGGTGGTTCTGCCCAACACTGCCCTCCATCTAAAGGCGCTGCTTGATTTTGAGGATAAAGATGGAGACAAGGTGGTGGCAGGAGATGAGTGGCTTTTCGAGGGACCTGGCACGTACATCCCCCGGAAGGAAGTGGAGGTCGTGGAGATCATTCAGGCCACCATCATCAGGCAGAACCAGGCTCTGCGGCTCAGGGCCCGCAAGGAGTGCTGGGACCGGGACGGCAAGGAGAGGGTGACAGGGGAAGAATGGCTGGTCACCACAGTAGGGGCGTACCTCCCAGCGGTGTTTGAGGAGGTTCTGGATTTGGTGGACGCCGTCATCCTTACGGAAAAGACAGCCCTGCACCTCCGGGCTCGGCGGAACTTCCGGGACTTCAGGGGAGTGTCCCGCCGCACTGGGGAGGAGTGGCTGGTAACAGTGCAGGACACAGAGGCCCACGTGCCAGATGTCCACGAGGAGGTGCTGGGGGTTGTGCCCATCACCACCCTGGGCCCCCACAACTACTGCGTGATTCTCGACCCTGTCGGACCGGATGGCAAGAATCAGCTGGGGCAGAAGCGCGTGGTCAAGGGAGAGAAGTCTTTTTTCCTCCAGCCAGGAGAGCAGCTGGAACAAGGCATCCAGGATGTGTATGTGCTGTCGGAGCAGCAGGGGCTGCTGCTGAGGGCCCTGCAGCCCCTGGAGGAGGGGGAGGATGAGGAGAAGGTCTCACACCAGGCTGGGGACCACTGGCTCATCCGCGGACCCCTGGAGTATGTGCCATCTGCCAAAGTGGAGGTGGTGGAGGAGCGCCAGGCCATCCCTCTAGACGAGAACGAGGGCATCTATGTGCAGGATGTCAAGACCGGAAAGGTGCGCGCTGTGATTGGAAGCACCTACATGCTGACCCAGGACGAAGTCCTGTGGGAGAAAGAGCTGCCTCCCGGGGTGGAGGAGCTGCTGAACAAGGGGCAGGACCCTCTGGCAGACAGGGGTGAGAAGGACACAGCTAAGAGCCTCCAGCCCTTGGCGCCCCGGAACAAGACCCGTGTGGTCAGCTACCGCGTGCCCCACAACGCTGCGGTGCAGGTGTACGACTACCGAGAGAAGCGAGCCCGCGTGGTCTTCGGGCCTGAGCTGGTGTCGCTGGGTCCTGAGGAGCAGTTCACAGTGTTGTCCCTCTCAGCTGGGCGGCCCAAGCGTCCCCATGCCCGCCGTGCGCTCTGCCTGCTGCTGGGGCCTGACTTCTTCACAGACGTCATCACCATCGAAACGGCGGATCATGCCAGGCTGCAACTGCAGCTGGCCTACAACTGGCACTTTGAGGTGAATGACCGGAAGGACCCCCAAGAGACGGCCAAGCTCTTTTCAGTGCCAGACTTTGTAGGTGATGCCTGCAAAGCCATCGCATCCCGGGTGCGGGGGGCCGTGGCCTCTGTCACTTTCGATGACTTCCATAAGAACTCAGCCCGCATCATTCGCACTGCTGTCTTTGGCTTTGAGACCTCGGAAGCGAAGGGCCCCGATGGCATGGCCCTGCCCAGGCCCCGGGACCAGGCTGTCTTCCCCCAAAACGGGCTGGTGGTCAGCAGTGTGGACGTGCAGTCAGTGGAGCCTGTGGATCAGAGGACCCGGGACGCCCTGCAACGCAGCGTCCAGCTGGCCATCGAGATCACCACCAACTCCCAGGAAGCGGCGGCCAAGCATGAGGCTCAGAGACTGGAGCAGGAAGCCCGCGGCCGGCTTGAGCGGCAGAAGATCCTGGACCAGTCAGAAGCCGAGAAAGCTCGCAAGGAACTTTTGGAGCTGGAGGCTCTGAGCATGGCCGTGGAGAGCACCGGGACTGCCAAGGCGGAGGCCGAGTCCCGTGCGGAGGCAGCCCGGATTGAGGGAGAAGGGTCCGTGCTGCAGGCCAAGCTAAAAGCACAGGCCTTGGCCATTGAAACGGAGGCTGAGCTCCAGAGGGTCCAGAAGGTCCGAGAGCTGGAACTGGTCTATGCCCGGGCCCAGCTGGAGCTGGAGGTGAGCAAGGCTCAGCAGCTGGCTGAGGTGGAGGTGAAGAAGTTCAAGCAGATGACAGAGGCCATAGGCCCCAGCACCATCAGGGACCTTGCTGTGGCTGGGCCTGAGATGCAGGTAAAACTGCTCCAGTCCCTGGGCCTGAAATCAACCCTCATCACCGATGGCTCCACTCCCATCAACCTCTTCAACACAGCCTTTGGGCTGCTGGGGATGGGGCCCGAGGGTCAGCCCCTGGGCAGAAGGGTGGCCAGTGGGCCCAGCCCTGGGGAGGGGATATCCCCCCAGTCTGCTCAGGCCCCTCAAGCTCCTGGAGACAACCACGTGGTGCCTGTACTGCGCTAACTCCTGATTAATACAATGGAAGTTTCTGGGCATTTACAATTTCAACA