Transcript asmbl_30295

Sequence
Transcript Sequence for observation asmbl_30295 of TGE0008945:
AAAAAATGGAACAGGCAAGAGCGGTGCCTACCTCATTCCCTTACTTGAACGGCTAGACCTGAAGAAGGACAATATACAAGCAATGGTGATTGTTCCCACTAGAGAACTTGCTCTACAGGTCAGTCAAATTTGCATCCAGGTCAGCAAACACATGGGAGGGGCCAAAGTGATGGCAACCACAGGAGGAACCAATTTACGGGATGACATAATGAGGCTTGATGACACAGTGCATGTGGTGATAGCTACCCCTGGAAGAATCCTGGATCTTATCAAGAAAGGAGTAGCAAAGGTTGATCATGTCCAGATGATAGTCTTGGATGAGGCAGATAAGTTGCTGTCACAGGATTTTGTGCAGATAATGGAGGATATTATTCTCACGCTACCTAAAAACAGACAGATTTTATTATATTCTGCTACTTTCCCTCTTAGTGTACAGAAGTTCATGAATTCCCATTTGCAGAAACCCTATGAGATTAACCTGATGGAGGAACTAACTTTGAAGGGAGTAACCCAGTACTACGCATATGTAACTGAGCGCCAAAAAGTACACTGCCTCAACACACTTTTCTCAAGGCTTCAGATAAACCAGTCGATCATTTTCTGTAACTCCTCTCAGCGAGTTGAATTGCTAGCCAAGAAGATTTCTCAACTGGGTTATTCTTGCTTCTATATCCATGCTAAAATGAGGCAGGAACATCGAAATCGTGTGTTTCATGATTTCCGAAATGGCTTATGCCGCAATCTTGTTTGCACTGATTTGTTTACCCGAGGTATTGATATACAAGCTGTGAATGTGGTAATAAACTTTGACTTTCCAAAGCTGGCAGAGACCTATCTCCATCGTATTGGAAGATCAGGTCGCTTTGGTCATCTTGGCTTAGCCATCAACTTGATCACATATGATGATCGCTTCAACCTGAAAAGTATTGAGGAGCAGCTGGGAACAGAAATTAAGCCTATCCCAAGCAACATTGACAAGAGCCTATATGTGGCAGAATACCACAGCGAGCCTGTAGAAGATGAGAAACCTTAACAAGCATGCTTTGACAAACTACAGAAGGCTCGTTCGGATCTGTGACACATTTTTTGGGGGGGAGGGGTATGCTCTTTGTGGGTTTTTCATGTTTTATTTTGGAACTATGAAGACTTAAAAGAGCTCAGACTTTTTTTTTAAACTGGTGAAGAGAAAAAAGCTGAAAAGAAGGAATTTACCTTTTTTGTTCCACTTGTTTGCACTGTGTGCTGACTGAACATTAGTTGCACTAACTGCTAGTTTTTAAAAAATGTTTTCTGGGGAAGGGGGACAAGGAAGGAGGAGAAAGAAGAGAAGGGGAGAAACCCTAAAAAGAGAAGAATCTTGATGAACACACAAGCTTGTCTGCAATTTCAAAATTCTCCAACAGCTGACTCTTGAGTGCATTTCAACTTCTCCCTGATTACTCATCCGTTTTTTAAGCCTGAAGAGCTTATTACTTATTTGTGCGAAGTGCCTTATGCTATGAGACCATTCAGAATATCTTTTAGATACAGCCCAAGGAATCAACAATAGTAATTTCTTTCCATTTTTCTTCCTTTCTTTTTAATTTTTGTCTTTTCCTTTTGATTTTAAGGTGAAGTCTCTTCCCTTTCTACCCAATACTCAAGCCCAGGGCTAGAAGATGAAACGTATTAGTAATGTTAAACACCATTTTTTTTTTCTTTATGTGGAGGAGTTGATATGCAACTGCATTTCATTCGCACTGTAAATACATGTATTTAAAAAAACAATCCCAAGTAAAAATTTCTTCTGGGCTGAGTAGATGCACCATCATTGCTCCCAAAGGAAAGAGCAGTCTATCATTGCAGGAGCCATATGACAAGCCTTTGTGCTCTATAGCAGAACACTAAAGACTGGTTTACATACGCCTCCATTAGCAGTTATGGCACTTGATGTGTAGACATGTCAGCCTTGACCCTCTTTCCTCTGTGGCAAAGCGTGTCCCATAGAAAATTGGGTGTGTATACTTGTATAAACTTTGTAAATAAGTTTTTTTCTGGGTTCATATATATATATACATATATATA