Transcript asmbl_46846

Sequence
Transcript Sequence for observation asmbl_46846 of TGE0056208:
TCCAGGTTCGAGGCTGGCGCGGCGCGGAGAGTGGGCTGGAGGCCGGGGCGGGACGCGTTGTGCAGCGGGTAAGCGCACGGCCGAGCGAGCATGGAGGGGGACCGGGTGGCCGGGCGGCCGGTGCTGTCGTCGTTACCAGTGCTACTGCTGCTGCCGTTGCTAATGTTGCGGGCCGCGGCGCTGCACCCAGACGAGCTCTTCCCACACGGGGAGTCGTGGGGGGACCAGCTCCTGCAGGAAGGCGACGACGAAAGCTCAGCCGTGGTGAAGCTGGCGAATCCCCTGCACTTCTACGAAGCCCGATTCAGCAACCTCTACGTGGGCACCAACGGCATCATCTCCACTCAGGACTTCCCCAGGGAAACGCAGTATGTGGACTATGATTTCCCCACCGACTTCCCGGCCATCGCCCCTTTTCTGGCGGACATCGACACGAGCCACGGCAGAGGCCGAGTCCTGTACCGAGAGGACACCTCCCCCGCAGTGCTGGGCCTGGCCGCCCGCTATGTGCGCGCTGGCTTCCCGCGCTCTGCGCGCTTTACCCCCACCCACGCCTTCCTGGCCACCTGGGAGCAGGTAGGCGCTTACGAGGAGGTCAAGCGCGGGGCGCTGCCCTCGGGAGAGCTGAACACTTTCCAGGCAGTTTTGGCATCTGATGGGTCTGATAGCTACGCCCTCTTTCTTTATCCTGCCAACGGCCTGCAGTTCCTTGGAACCCGCCCCAAAGAGTCTTACAATGTCCAGCTTCAGCTTCCAGCTCGGGTGGGCTTCTGCCGAGGGGAGGCTGATGATCTGAAGTCAGAAGGACCATATTTCAGCTTGACTAGCACTGAACAGTCTGTGAAAAATCTCTATCAACTAAGCAACCTGGGGATCCCTGGAGTGTGGGCTTTCCATATCGGCAGCACTTCCCCGTTGGACAATGTCAGGCCAGCTGCAGTTGGAGACCTTTCCGCTGCCCACTCTTCTGTTCCCCTGGGACGTTCCTTCAGCCATGCTACAGCCCTGGAAAGTGACTATAATGAGGACAATTTGGATTACTATGATGTGAATGAGGAGGAAGCTGAATACCTTCCGGGTGAACCAGAGGAGGCATTGAATGGCCACAGCAGCATTGATGTTTCCTTCCAATCCAAAGTGGATACAAAGCCTTTAGAGGAATCTTCCACCTTGGATCCTCACACCAAAGAAGGAACATCTCTGGGAGAGGTAGGGGGCCCAGATTTAAAAGGCCAAGTTGAGCCCTGGGATGAGAGAGAGACCAGAAGCCCAGCTCCACCAGAGGTAGACAGAGATTCACTGGCTCCTTCCTGGGAAACCCCACCACCGTACCCCGAAAACGGAAGCATCCAGCCCTACCCAGATGGAGGGCCAGTGCCTTCGGAAATGGATGTTCCCCCAGCTCATCCTGAAGAAGAAATTGTTCTTCGAAGTTACCCTGCTTCAGGTCACACTACACCCTTAAGTCGAGGGACGTATGAGGTGGGACTGGAAGACAACATAGGTTCCAACACCGAGGTCTTCACGTATAATGCTGCCAACAAGGAAACCTGTGAACACAACCACAGACAATGCTCCCGGCATGCCTTCTGCACGGACTATGCCACTGGCTTCTGCTGCCACTGCCAATCCAAGTTTTATGGAAATGGGAAGCACTGTCTGCCTGAAGGGGCACCTCACCGAGTGAATGGGAAAGTGAGTGGCCACCTCCACGTGGGCCATACACCCGTGCACTTCACTGATGTGGACCTGCATGCGTATATCGTGGGCAATGATGGCAGAGCCTACACGGCCATCAGCCACATCCCACAGCCAGCAGCCCAGGCCCTCCTCCCCCTCACACCAATTGGAGGCCTGTTTGGCTGGCTCTTTGCTTTAGAAAAACCTGGCTCTGAGAACGGCTTCAGCCTCGCAGGTGCTGCCTTTACCCATGACATGGAAGTTACATTCTACCCGGGAGAGGAGACGGTTCGTATCACTCAAACTGCTGAGGGACTTGACCCAGAGAACTACCTGAGCATTAAGACCAACATTCAAGGCCAGGTGCCTTACGTCTCAGCAAATTTCACAGCCCACATCTCTCCCTACAAGGAGCTGTACCACTACTCCGACTCCACTGTGACCTCTACAAGTTCCAGAGACTACTCTCTGACTTTTGGTGCAATCAACCAAACATGGTCCTACCGCATCCACCAGAACATCACTTACCAGGTGTGCAGGCACGCCCCCAGACACCCGTCCTTCCCCACCACCCAGCAGCTGAACGTGGACCGGGTCTTTGCCTTGTATAATGACGAAGAAAGAGTGCTTAGATTTGCTGTGACCAATCAAATTGGCCCGGTCAAAGAGGATTCAGACCCCACTCCGGGGAATCCTTGCTATGATGGGAGCCACATGTGTGACACAACAGCACGGTGCCATCCAGGGACAGGTGTAGATTACACCTGTGAGTGCGCATCTGGGTACCAGGGAGATGGACGGAACTGTGTGGATGAAAATGAATGTGCAACTGGCTTTCATCGCTGTGGCCCCAACTCTGTATGTATCAACTTGCCTGGAAGCTACAGGTGTGAGTGCCGGAGTGGTTATGAGTTTGCAGATGACCGGCATACTTGCATCTTGATCACCCCACCTGCCAACCCCTGTGAGGATGGCAGTCATACCTGTGCTCCTGCTGGGCAGGCCCGGTGTGTTCACCATGGAGGCAGCACGTTCAGCTGTGCCTGCCTGCCTGGTTATGCCGGCGATGGGCACCAGTGCACTGATGTAGATGAATGCTCAGAAAACAGATGTCACCCTGCAGCTACCTGCTACAATACTCCTGGTTCCTTCTCCTGCCGTTGTCAACCCGGATATTATGGGGATGGATTTCAGTGCATACCTGACTCCACCTCAAGCCTGACACCCTGTGAACAACAGCAGCGCCATGCCCAGGCCCAGTATGCCTACCCTGGGGCCCGGTTCCACATCCCCCAATGCGACGAGCAGGGCAACTTCCTGCCCCTACAGTGTCATGGCAGCACTGGTTTCTGCTGGTGCGTGGACCCTGATGGTCATGAAGTTCCTGGTACCCAGACTCCACCTGGCTCCACCCCGCCTCACTGTGGACCATCACCAGAGCCCACCCAGAGGCCCCCGACCATCTGTGAGCGCTGGAGGGAAAACCTGCTGGAGCACTACGGTGGCACCCCCCGGGATGACCAGTACGTGCCCCAGTGCGATGACCTGGGCCACTTCATCCCCCTGCAGTGCCACGGAAAGAGCGACTTCTGCTGGTGTGTGGACAAAGATGGCAGAGAGGTGCAGGGCACCCGCTCCCAGCCAGGCACCACCCCTGCGTGTATACCCACCGTCGCTCCACCCATGGTCCGGCCCACGCCCCGGCCAGATGTGACCCCTCCATCTGTGGGCACCTTCCTGCTCTATACTCAGGGCCAGCAGATTGGCTACTTACCCCTCAATGGCACCAGGCTTCAGAAGGATGCAGCTAAGACCCTGCTGTCTCTGCATGGCTCCATAATCGTGGGAATTGATTACGACTGCCGGGAGAGGATGGTGTACTGGACAGATGTTGCTGGACGGACAATCAGCCGTGCTGGTCTGGAACTGGGAGCAGAGCCTGAGACGATCGTGAATTCAGGTCTGATAAGCCCTGAAGGACTTGCCATAGACCACATCCGCAGAACAATGTACTGGACGGACAGTGTCCTGGATAAGATAGAGAGCGCCCTGCTGGATGGCTCTGAGCGCAAGGTCCTCTTCTACACAGATCTGGTGAATCCCCGTGCCATCGCTGTGGATCCAATCCGAGGCAACTTGTACTGGACAGACTGGAATAGAGAAGCTCCTAAAATTGAAACGTCATCTTTAGATGGAGAAAACAGAAGAATTCTGATCAATACAGACATTGGATTGCCCAATGGCTTAACCTTTGACCCTTTCTCTAAACTGCTCTGCTGGGCAGATGCAGGAACCAAAAAACTGGAGTGTACACTACCTGATGGAACTGGACGGCGTGTCATTCAAAACAACCTCAAGTACCCCTTCAGCATCGTAAGCTATGCAGATCACTTCTACCACACAGACTGGAGGAGGGATGGTGTTGTATCAGTAAATAAACATAGTGGCCAGTTTACTGATGAGTATCTCCCAGAACAACGATCTCACCTCTACGGGATAACTGCAGTCTACCCCTACTGCCCAACAGGAAGAAAGTAAGTACAGTAATGTAAAGGAAGACTTGGAGTTTACAATCAGAACCTGGACCCTAAAGAACAGTGACTGCAAAGGCAAAGAAAGTAAAAAAGGAATTGGCCATTAGACGTTCCTGAGCATCCAAGATGAACATTTTGTAGTGCAAAAAGACTTTTGTGAAAAGCTGATACCTCAATCTTTACTACTGTATTTTTAAAAATGAAGGTTGTTATTGCAAGTTTAAAAAGGTAACAGAATTTTAACTGTTGCTTATTAAAGCAACTTCTTGTAAACATTTATCATTAATATTTAAAAGATCAAATTCATTCAACTAAGAATTAGAGTTTAAGACTCTAAACCTGATTTTTGCCATGGATTCCTTCTGGCCAAGAAATTAAAGCACATGTGATCAATATAACAATATAATCCTAAACCTTGACAGTTGGAGAAGCCAATGCAGAACTGATGGGAAAGGACCAATTATTTATAGTTTCCCAACAAAAGTTCTAAGATTTTTTACCTCTGCATCAGTGCATTTCTATTTATATCAAAAGGTGCTAAAATGATTCAATTTGCATTTTCTGATCCTGTAGTGCCTCTATAGAAGTACCCACAGAAAGTAAAGTATCACATTTATAAATACCAAAGATGTAACAATTTTAAAATTTTCTAGATTACTCCAATAAAGTGTTTTAAGTTTTCCTATGACTTAAGGATCTATATTGTCTCTAGGACAAAGCTGGGGGTTGGCATATATGCCTTAACCACAAAGGAGAAAGGTGATTTATGCAAACATACAGTACATAATAAAAATTCTACTTTCCTAAACTTTATTAAAGAAAAAAGCAATAAGCAATGGTGGTAAATCTCTAGAACATACCCAATTTTCTGGGCTTCCTCCCCCGAGAATGTGACATTT