Transcript asmbl_45665

Sequence
Transcript Sequence for observation asmbl_45665 of TGE0000365:
CGTGGGGGCTCAGCGTGCACCCTTCTTTGTGCTCGGGTTAGGAGGAGCTAGGCTGCCATCGGGCCGGTGCAGATACGGGGTTGCTCTTTTGCTCATAAGAGGGGCTTCGCTGGCAGTCTGAACGGCAAGCTTGAGCAACGCGGTAAAAATATTGCTTCGGTGGGTGACGCGGTACAGCTGCCCAAGGGCGTTCGTAACGGGAATGCCGAAGCGTGGGAAAAAGGGAGCGGTGGCGGAAGACGGGGATGAGCTCAGGACAGAGCCAGAGGCCAAGAAGAGTAAGACGGCCGCAAAGAAAAATGACAAAGAGGCAGCAGGAGAGGGCCCAGCCCTGTATGAGGACCCCCCAGATCAGAAAACCTCACCCAGTGGCAAACCTGCCACACTCAAGATCTGCTCTTGGAATGTGGATGGGCTTCGAGCCTGGATTAAGAAGAAAGGATTAGATTGGGTAAAGGAAGAAGCCCCAGATATACTGTGCCTTCAAGAGACCAAATGTTCAGAGAACAAACTACCAGCTGAACTTCAGGAGCTGCCTGGACTCTCTCATCAATACTGGTCAGCTCCTTCGGACAAGGAAGGGTACAGTGGCGTGGGCCTGCTTTCCCGCCAGTGCCCACTCAAAGTTTCTTACGGCATAGGCGATGAGGAGCATGATCAGGAAGGCCGGGTGATTGTGGCTGAATTTGACTCGTTTGTGCTGGTAACAGCATATGTACCTAATGCAGGCCGAGGTCTGGTACGACTGGAGTACCGGCAGCGCTGGGATGAAGCCTTTCGCAAGTTCCTGAAGGGCCTGGCTTCCCGAAAGCCCCTTGTGCTGTGTGGAGACCTCAATGTGGCACATGAAGAAATTGACCTTCGCAACCCCAAGGGGAACAAAAAGAATGCTGGCTTCACGCCACAAGAGCGCCAAGGCTTCGGGGAATTACTGCAGGCTGTGCCACTGGCTGACAGCTTTAGGCACCTCTACCCCAACACACCCTATGCCTACACCTTTTGGACTTATATGATGAATGCTCGATCCAAGAATGTTGGTTGGCGCCTTGATTACTTTTTGTTGTCCCACTCTCTGTTACCTGCATTGTGTGACAGCAAGATCCGTTCCAAGGCCCTCGGCAGTGATCACTGTCCTATCACCCTATACCTAGCACTGTGACACCACCCCTAAATCACTTTGAGCCTGGGAAATAAGCCCCCTCAACTACCATTCCTTCTTTAAACACTCTTCAGAGAAATCTGCATTCTATTTCTCATGTATAAAACTAGGAATCCTCCAACCAGGCTCCTGTGATAGAGTTCTTTTAAGCCCAAGATTTTTTATTTGAGGGTTTTTTGTTTTTTAAAAAAAAATTGAACAAAGACTACTAATGACTTTGTTTGAATTATCCACATGAAAATAAAGAGCCATAGTTTCAGCC